Herpes virus EBV (Epstein-Barr Virus) detection kit
A detection kit and kit technology, applied in the direction of microbial determination/inspection, fluorescence/phosphorescence, biochemical equipment and methods, etc., can solve the problem of low detection sensitivity, achieve high detection sensitivity, wide detection range, and fast operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] The present embodiment provides a specific EBV detection kit, which includes the following components:
[0025] ① EBV concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.
[0026] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.
[0027] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+05copies / ml, and the 100 base pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTC GTAGCCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.
[0028] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleoti...
Embodiment 2
[0034] This example provides the operation steps for detecting EBV-DNA in unknown samples such as plasma, throat swab, and peripheral blood using the kit described in Example 1 above:
[0035] 1. Reagent preparation
[0036] According to the number of samples to be tested, EBV negative control, EBV positive control, and EBV quantitative reference products A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 1.0 μl / person and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.
[0037] 2. Nucleic acid extraction
[0038] 1. Plasma sample: Take 100 μl of plasma sample, add an equal volume of EBV concentrate, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, add 50 μl of nucleic acid...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com