Method for rapidly screening hybrid strains of straw mushroom by using molecular marker
A hybrid strain and molecular marker technology, applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., can solve the restriction on the development of straw mushroom hybrid breeding work, the lack of methods for screening hybrid strains, and the lack of locks on the straw mushroom mycelium. In order to achieve good application prospects, speed up research and development work, and shorten the detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] (1) Primer synthesis
[0029] The specific primers designed for the gene sequence of the mating type A site of the monokaryotic strain A1 of volvulus volvulus are A1F:
[0030] AGGGCATTCCAACCTATTCGCTTTC;
[0031] A1R: AATGTGAACAGTTTGAGCGGAGT.
[0032] (2) Straw mushroom mycelium culture
[0033] The monosporus strain of volvoxin was inoculated on PDA plate medium and cultured at 32°C; the composition of PDA plate medium was: 200g of sliced potato juice filtrate was added, 20g of glucose and 20g of agar were added, and the volume was made up to 1000mL with water.
[0034] (3) Determine the mating genotype of monokaryotic strains
[0035] Pick the hyphae of V. volvulus, and use the Phire Plant Direct PCR Kit (FINNZYMES) kit to directly detect the genotype of the mating type of the strain.
[0036] (4) Straw mushroom hybridization test
[0037] Inoculate the monospore strains of the mating type genotype on the PDA plate medium respectively, culture at 32°C for 5 day...
Embodiment 2
[0043] (1) Primer synthesis
[0044] The specific primer designed for the gene sequence of the mating type A locus of the monokaryotic strain A2 of volvulus is A2F: CACTATCTCCTTGCGTTTGTTATG;
[0045] A2R: ATAACCAAACGCCAGAAACACTA.
[0046] (2) Straw mushroom mycelium culture
[0047] The monosporus strain of volvoxin was inoculated on PDA plate medium and cultured at 32°C; the composition of PDA plate medium was: 200g of sliced potato juice filtrate was added, 20g of glucose and 20g of agar were added, and the volume was made up to 1000mL with water.
[0048](3) Determine the mating genotype of monokaryotic strains
[0049] Pick the hyphae of V. volvulus, and use the Phire Plant Direct PCR Kit (FINNZYMES) kit to directly detect the genotype of the mating type of the strain.
[0050] (4) Straw mushroom hybridization test
[0051] Inoculate the monospore strains of the mating type genotype on the PDA plate medium respectively, culture at 32°C for 5 days, punch holes in the ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap