Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multivalent immunostimulation nanoformula, preparation method and application thereof

A technology of immune stimulation and nano-preparation, applied in the field of biomedicine, can solve the problems of easy degradation of CpGODN, low uptake rate, and immunostimulatory effect of side effects of CpGODN, and achieve the effect of high cell uptake rate, outstanding effect and good immunostimulatory activity

Inactive Publication Date: 2013-04-03
SHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to overcome the easy degradation of unmodified CpG ODN in the prior art, the low uptake rate and the need for high-dose repeated administration, while the modified CpG ODN has various side effects and low immunostimulatory effects at low doses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multivalent immunostimulation nanoformula, preparation method and application thereof
  • Multivalent immunostimulation nanoformula, preparation method and application thereof
  • Multivalent immunostimulation nanoformula, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The preparation of embodiment 1 nano gold

[0051] Reagents include:

[0052] Chlorauric acid was purchased from Aladdin Company, and analytically pure trisodium citrate was purchased from Sinopharm Chemical Reagent Co., Ltd.

[0053] The preparation process includes the following steps:

[0054] (1) Take 1% chloroauric acid HAuCl 4 Solution 1ml and 99ml of Milli-Q water were poured into a clean distillation flask to make 0.01% HAuCl 4 For the working solution, add a stir bar, heat and stir on a magnetic stirring heater;

[0055] (2) After the solution is completely boiled, adjust the speed to 30, and quickly add 3.5ml of freshly prepared 10mg / ml trisodium citrate aqueous solution at one time;

[0056] (3) Keep the solution boiling and stir rapidly for 20 minutes, stop heating, continue stirring, and cool down;

[0057] (4) Aging overnight, filtering with a 0.22 μm filter membrane to obtain a 15 nm nano-gold aqueous solution with a substantially uniform particle si...

Embodiment 2

[0059] Preparation and characterization of embodiment 2 nano-gold complex

[0060] Reagents include:

[0061] The HPLC-purified CpG ODN was synthesized from Invitrogen, and analytically pure sodium chloride, disodium hydrogen phosphate, and sodium dihydrogen phosphate were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0062] The preparation process includes the following steps:

[0063] (1) Take 1ml of nano-gold and centrifuge at 12000rpm at 4°C for 20 min, discard 800 μl of supernatant, and resuspend the precipitate to obtain a 5-fold concentrated gold nano-solution.

[0064](2) Take 1ml of 5-fold concentrated gold nanoparticles in a 1.5mL centrifuge tube to a final concentration of 10nM, add 100μM CpG ODN to a final concentration of 3μM, gently pipette and mix well, and shake overnight at 25°C and 400rpm.

[0065] Wherein, the CpG ODN is CpG ODN-polyA5 (its sequence is SEQ ID NO.1: TCCATGACGTTCCTGACGTTTTTTTAAAAA), CpG ODN-polyA10 (its sequence is SEQ ID NO.2: TCCAT...

Embodiment 3

[0074] Example 3 Detection of cell viability and uptake rate

[0075] Reagents include:

[0076] Raw264.7 cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, thiazolium blue (MTT), sodium dodecylsulfonate (SDS), Hoechst33258 were purchased from Sigma-Aldrich, and Cy5-labeled fluorescently modified CpGODN was purchased from Invitrogen

[0077] MTT cell viability detection method:

[0078] (1) Plate the day before, plate 2×105 cells per well of a 24-well plate, and culture overnight at 37°C with 5% CO2.

[0079] (2) Wash once with 500μl PBS, add fresh medium containing 5-25nM CpG ODN-polyA-nanogold to each well, and continue culturing for 24 hours

[0080] (3) Add 50 μl of 5 mg / ml MTT to each well, and after incubating at 37 degrees for 4 hours, blue-purple insoluble formazan will be produced. At this time, add 1ml of 10% SDS (pH2-3) to each well to dissolve formazan, and incubate overnight at 37 degrees

[0081] (4) Centrifuge at 12000rpm for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a multivalent immunostimulation nanoformula. The preparation method comprises the steps of: (1) providing a nanogold aqueous solution; (2) modifying the 3' terminal of CpG ODN (oligodeoxynucleotides) by using polyadenylic acid to obtain CpG ODN-polyA; and (3) assembling the CpG ODN-polyA to nanogold to form the multivalent immunostimulation nanoformula. The invention further provides the multivalent immunostimulation nanoformula obtained by the preparation method and application of the multivalent immunostimulation nanoformula. Compared with the traditional CpG ODN, the multivalent immunostimulation nanoformula has very high stability, no influence on cell activity, high cellular uptake rate, low administration dosage, good immunostimulation activity and remarkable effect during administration of low dosage.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a multivalent immunostimulatory nano-preparation and its preparation method and application. Background technique [0002] CpG DNA is a kind of DNA sequence with immune activation function and the core of unmethylated CpG motif, which includes artificially synthesized oligodeoxynucleotides (oligodeoxynucleotides, referred to as CpG ODN at this time) ) and the genomic DNA of lower organisms such as bacteria, viruses, and invertebrates in nature. Among them, CpG motifs (CpG motifs) refer to a class of oligodeoxyribonucleotides with unmethylated cytosine and guanine nucleotides as the core. [0003] CpG DNA was first discovered in Bacillus Calmette-Guerin (BCG) extract, it can stimulate the activation or proliferation of various immune cells, produce a variety of cytokines, and has a strong immune activation function. The frequency of CpGDNA in bacterial and viral genomes is much higher...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K47/48A61K31/7088A61K9/14A61P37/04
Inventor 黄庆陈楠魏敏裴洁李凡孙艳红李晓明樊春海
Owner SHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com