Multivalent immunostimulation nanoformula, preparation method and application thereof
A technology of immune stimulation and nano-preparation, applied in the field of biomedicine, can solve the problems of easy degradation of CpGODN, low uptake rate, and immunostimulatory effect of side effects of CpGODN, and achieve the effect of high cell uptake rate, outstanding effect and good immunostimulatory activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The preparation of embodiment 1 nano gold
[0051] Reagents include:
[0052] Chlorauric acid was purchased from Aladdin Company, and analytically pure trisodium citrate was purchased from Sinopharm Chemical Reagent Co., Ltd.
[0053] The preparation process includes the following steps:
[0054] (1) Take 1% chloroauric acid HAuCl 4 Solution 1ml and 99ml of Milli-Q water were poured into a clean distillation flask to make 0.01% HAuCl 4 For the working solution, add a stir bar, heat and stir on a magnetic stirring heater;
[0055] (2) After the solution is completely boiled, adjust the speed to 30, and quickly add 3.5ml of freshly prepared 10mg / ml trisodium citrate aqueous solution at one time;
[0056] (3) Keep the solution boiling and stir rapidly for 20 minutes, stop heating, continue stirring, and cool down;
[0057] (4) Aging overnight, filtering with a 0.22 μm filter membrane to obtain a 15 nm nano-gold aqueous solution with a substantially uniform particle si...
Embodiment 2
[0059] Preparation and characterization of embodiment 2 nano-gold complex
[0060] Reagents include:
[0061] The HPLC-purified CpG ODN was synthesized from Invitrogen, and analytically pure sodium chloride, disodium hydrogen phosphate, and sodium dihydrogen phosphate were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0062] The preparation process includes the following steps:
[0063] (1) Take 1ml of nano-gold and centrifuge at 12000rpm at 4°C for 20 min, discard 800 μl of supernatant, and resuspend the precipitate to obtain a 5-fold concentrated gold nano-solution.
[0064](2) Take 1ml of 5-fold concentrated gold nanoparticles in a 1.5mL centrifuge tube to a final concentration of 10nM, add 100μM CpG ODN to a final concentration of 3μM, gently pipette and mix well, and shake overnight at 25°C and 400rpm.
[0065] Wherein, the CpG ODN is CpG ODN-polyA5 (its sequence is SEQ ID NO.1: TCCATGACGTTCCTGACGTTTTTTTAAAAA), CpG ODN-polyA10 (its sequence is SEQ ID NO.2: TCCAT...
Embodiment 3
[0074] Example 3 Detection of cell viability and uptake rate
[0075] Reagents include:
[0076] Raw264.7 cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, thiazolium blue (MTT), sodium dodecylsulfonate (SDS), Hoechst33258 were purchased from Sigma-Aldrich, and Cy5-labeled fluorescently modified CpGODN was purchased from Invitrogen
[0077] MTT cell viability detection method:
[0078] (1) Plate the day before, plate 2×105 cells per well of a 24-well plate, and culture overnight at 37°C with 5% CO2.
[0079] (2) Wash once with 500μl PBS, add fresh medium containing 5-25nM CpG ODN-polyA-nanogold to each well, and continue culturing for 24 hours
[0080] (3) Add 50 μl of 5 mg / ml MTT to each well, and after incubating at 37 degrees for 4 hours, blue-purple insoluble formazan will be produced. At this time, add 1ml of 10% SDS (pH2-3) to each well to dissolve formazan, and incubate overnight at 37 degrees
[0081] (4) Centrifuge at 12000rpm for...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com