Rapid screening method of zinc finger protein

A zinc finger protein and screening method technology, applied in the biological field, can solve problems such as heavy workload, low success rate, and difficult implementation, and achieve the effect of cost reduction and reliable screening results

Inactive Publication Date: 2015-05-27
SHAANXI NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 1. These methods are all carried out in bacteria or yeast, so the combination of zinc fingers and DNA does not necessarily reflect the actual binding ability in mammalian cells
[0005] 2. These screening methods are not sensitive enough, and zinc finger proteins with weak binding ability are easily detected or slightly eliminated.
[0006] 3. The success rate of these screening methods is very low, the workload is heavy, and it is difficult for general laboratories to implement

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid screening method of zinc finger protein
  • Rapid screening method of zinc finger protein
  • Rapid screening method of zinc finger protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Taking the screening of zinc finger proteins targeting human PGRN as an example to construct a zinc finger nuclease targeting human PGRN gene, the steps are as follows:

[0040] 1. Construction of a small zinc finger protein library targeting human PGRN

[0041] Since zinc finger nucleases exist in pairs and form dimers to play a role, it is necessary to screen a pair of zinc finger proteins. The binding sites of the two zinc finger proteins are respectively located on the two complementary DNA strands of the target gene. The recognition sites are separated by 5-7 bases, so the final target sequence is a 23-25bp DNA fragment. ZiFiT, an online zinc finger protein prediction software provided by the Zinc Finger Consortium, provides a service dedicated to predicting paired zinc finger protein target sites for zinc finger nucleases. The specific method is as follows:

[0042] Find the genome sequence NG_007886 of human PGRN from NCBI, and use the online zinc finger protei...

Embodiment 2

[0142] Taking the screening of zinc finger protein targeting human PGRN as an example, the steps are as follows:

[0143] In the synthesis step 2-(1) of the nuclear localization signal and detection label in Example 1, different detection labels are added to the 5' end of the nuclear localization signal of the chimeric transcription factor assembled from the left and right zinc finger proteins, They are the His tag on the left, the myc tag on the right, and the detection tags on the left and right can also be replaced with each other. The left and right nuclear localization signals and detection tags were synthesized in the full length of Shanghai Sangong, and their sequences are:

[0144] left side

[0145] ATCGATATGCACCATCACCACCATCACGCACCAAAGAAAAAGCGGAAGGTAGATTCAAAGATCATGATGGCGATTACAAGGACCACGATATCAAGCTT

[0146] Right

[0147]GAATTCATGCAGAAGCTGATCAGCGAGGAGGACCTGGCGCCCAAGAAGAAACGAAAGGTCTATCTCTTACGATGTGCCAGACTACGCCGGGTATCCATATGATGTGCCTGACTATGCCGGCAGCGAGGGTACC

[0148] In t...

Embodiment 3

[0163] In the nuclear localization signal synthesis step 2-(1) of Example 1, the full-length nuclear localization signal was synthesized in Shanghai Sangon, and its sequence is:

[0164] left side:

[0165] ATcGAtATGGCACCAAAGAAAAAGCGGAAGGTAGATTACAAGATCATGATGGCGATTACAAGGACCACGATATCAAGCTT;

[0166] Right:

[0167] GAATTCATGGCGCCCAAGAAGAAACGAAAGGTCTATCCTTACGATGTGCCAGACTACGCCGGGTATCCATATGATGTGCCTGACTATGCCGGAGCGGTACC

[0168] At the same time, ClaI and HindIII sites were introduced at both ends of the left nuclear localization signal, and EcoRI and KpnI sites were introduced at both ends of the right nuclear localization signal.

[0169] In the cloning step 2-(2) of the transcriptional activation domain p65AD of the transcription factor p65, the following primers were designed and synthesized according to the DNA sequence of p65AD, because different enzyme cleavage sites were introduced at the two ends of the zinc finger protein on the left and right point, respectively cloned p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a rapid screening method of zinc finger protein. According to the invention, potential zinc finger protein target sequences and corresponding zinc fingers in gene are predicted by using on-line zinc finger protein prediction software; and overlapped polymerase chain reaction is carried out, such that a zinc finger protein library is obtained. The zinc finger proteins are fused with a transcriptional activation, such that a chimeric transcription factor is constructed. A chimeric promoter composed of a zinc finger protein target sequence and a promoter core element and a downstream reporter gene form a zinc finger protein detection carrier. A carrier expressing the chimeric transcription factor and the zinc finger protein detection carrier are co-transfected into a mammalian cell. Binding capacities of the zinc finger protein and the target sequence is reflected by the expression intensity of the reporter gene.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a rapid screening method for zinc finger proteins. technical background [0002] Zinc finger protein was first discovered in 1983 by the Nobel laureate Klug and his colleagues in the transcription factor TFIIIA of Xenopus oocytes. It is by far the most widely distributed protein in the eukaryotic genome. Nearly 1% of the sequences coded for proteins containing zinc fingers, which were named for their shape resembling a finger. Since the discovery of the Xenopus transcription factor TFIII, many researchers have carried out a series of studies, revealing the broad application prospects of artificial zinc finger proteins. According to the differences in the conserved domains of zinc finger proteins, zinc finger proteins can be divided into three groups: C2H2 type (Krüppel-related type), C4 type and C6 type. C2H2 zinc fingers are the most common DNA-binding motifs in eukary...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K1/14C12N15/63C12Q1/66C12Q1/34G01N21/64
Inventor 夏海滨张伟锋
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap