Sindbis virus XJ-160 defective replicon and construction method and application thereof
An XJ-160, defect-type technology, applied in biochemical equipment and methods, introduction of foreign genetic material using vectors, measurement/inspection of microorganisms, etc., can solve problems such as the detection of Sindbis virus replicon A virus, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0399] 1. Construction of XJ-160 viral plasmid-type replicon vector
[0400] (1) Method overview:
[0401] Using the XJ-160 virus infectious whole gene clone pBR-XJ160 as a template, use XJ 1 (+) and XJ 1 (-), XJ 2 (+) and XJ 2 (-), XJ 3 (+) and XJ 3 (-) Three pairs of primers carry out PCR, and the non-structural gene sequence of the virus is divided into three fragments for amplification: XJ1 (1-2527nt), XJ2 (2527-5161nt), XJ3 (5161-7562nt), and the primer sequence used for cloning is :
[0402] XJ 1 (+) GCTAGC ATTGACGGCGTAGTACACAC (NheI site) 1-20nt
[0403] XJ 1 (-) TGCTTA GGATCC CCGCGAAGTAC (BamHI site) 2527-2505nt
[0404] XJ 2 (+) TTCGCGG GGATCC TAAGCAGT (BamHI site) 2509-2529nt
[0405] XJ 2 (-) GAATTC CGTCCGCGGCAGGTGGC (EcoRI site) 5161-5138nt
[0406] XJ 3 (+) ATCCTGCCGCGGACG GAATTC CGCTT (EcoRI site) 5148-5174nt
[0407] XJ 3 (-) GCGGCCGC AGTAGGGGTGTTACAG (NotI site) 7562-7539nt
[0408] It was cloned into the downstream of the eukaryot...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com