Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene recombined Paenibacillus russica and its construction method and application

A technology of bacillus and gene recombination, applied in the field of genetic engineering, can solve problems such as high cost and high oxygen consumption, and achieve the effects of improving fluidity, improving utilization rate, and improving oxygen uptake capacity

Active Publication Date: 2017-03-08
杨凌静玥生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2002, Yu Huimin and others constructed the VHb-integrated pHB (Poly-β-hydroxybutyrate) producing bacteria VG1 (Ptu14), which solved the problems of high oxygen consumption and high cost in the production process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene recombined Paenibacillus russica and its construction method and application
  • Gene recombined Paenibacillus russica and its construction method and application
  • Gene recombined Paenibacillus russica and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Embodiment one, Construction of Gene Recombinant Paenibacillus Peirui:

[0077] (1) PCR amplification of P 43 Promoter

[0078] According to the accession number NO.K02174 of P 43 sequence, designed primer P 43 -F: CCC AAGCTT GATAGGTGGTATGTTTCGCTTG, the underlined Hind III is the restriction site; P 43 -R: GGTTTGCTGGTCTAACATGTGTACATTCCTCTTT, the primers were synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd.; the genomic DNA of Bacillus subtilis (which can be extracted by using the CTAB method (cetyltrimethylammonium bromide) ) as a template for gene amplification, Bacillus subtilis was purchased from the China Agricultural Microorganism Culture Collection Center (ACCC), P 43 -F / P 43 -R is a primer to amplify P 43 Promoter, reaction system: 10ul of 10×amplification buffer, 200umol / L of each of the 4 dNTP (TaKaRa) mixtures, primer P 43 -F working concentration is 50pmol / L, primer P 43 -R working concentration is 50pmol / L, template DNA 1...

Embodiment 2

[0087] Embodiment two, Fermentation process of polypeptide antibiotics produced by gene recombinant Paenibacillus russica:

[0088] Polypeptide antibiotics fermentation process (such as Image 6 shown), the main process flow includes strain activation, primary seed tank fermentation culture, secondary seed tank fermentation culture and production fermenter culture.

[0089] (1) Activation of bacteria

[0090] Streak-inoculate the preserved genetically recombinant Paenibacillus russianus BC39 on the slant of LB solid seed medium. Before inoculation, sterilize the triangular flask containing the medium at 121°C for 30 minutes, and then inoculate it at 30°C after inoculation. Cultivate for 30-48 hours, prepare spore liquid, and use 5% inoculum for seed tank inoculation.

[0091] (2) Seed tank fermentation

[0092] Sterilize the first-level seed tank first, put it into the medium and then sterilize it, cool it to 30°C, put the spore liquid into the culture medium, and feed it...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene-engineered bacterium of gene-recombined peoriae paenibacillus, and a construction method and application of the gene-engineered bacterium. Gene-recombined peoriae paenibacillus BC39 with vitreoscilla hemoglobin regulated and controlled by a P43 strong promoter is constructed by constructing a gene-recombination integrative vector with a peoriae paenibacillus LXH-B-1 strain as host bacteria. The gene-engineered bacterium of the gene-recombined peoriae paenibacillus is capable of intracellularly expressing the vitreoscilla hemoglobin, so that the utilization rate of oxygen by the peoriae paenibacillus, the cell biomass liveweight and the yield of catalysate polypeptide antibiotics can be improved; and the yield of the catalysate polypeptide antibiotics of the engineering strain is increased by 45% compared with that of the original strain; and therefore, an effective way is provided for solving the problem of insufficient oxygen supply in the cell culture and catalysis process of the peoriae paenibacillus.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the expression of the hemoglobin gene of Vitiligo hyaline in Paenibacillus peirui, thereby improving the oxygen utilization rate of the Paenibacillus peirui thallus, so as to improve the effectiveness of polypeptide antibiotics Yield. Background technique [0002] In agricultural production, the use of chemical pesticides and chemical fertilizers has caused environmental pollution, ecological deterioration, and agricultural 3R issues, posing a huge threat and challenge to food safety, human health, and sustainable agricultural development. Therefore, to develop sustainable agriculture, it is necessary to reduce the use of chemical pesticides and chemical fertilizers and find effective alternatives. [0003] Microbial pesticides and microbial fertilizers have the characteristics of long-lasting and non-polluting environment, and are the most effective subst...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/63C12P21/02C12R1/01
Inventor 杨轩段军娜杨长锁安德荣
Owner 杨凌静玥生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com