Method and kit for rapidly detecting salmonella living cells in feed by combining ethidium monoazide (EMA) and polymerase chain reaction (PCR)
A Salmonella, live cell technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc. The effect of positive rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0028] The present invention will be further described below in conjunction with embodiment:
[0029] Such as figure 1 As shown, the casing 1 of the covalent cross-linking exposure device of the present invention is provided with a visible window 3, a dodge door 5, a halogen lamp switch 6, an ultraviolet lamp switch 7 and a main power switch 8, and the dodge door 5 and the casing 1 hinged, a 500W halogen lamp 4 is provided on the inner wall of the top of the box body 1, and two ultraviolet lamp tubes 2 are respectively installed on the inner walls of both sides of the box body 1, and the two parallel ultraviolet lamp tubes 2 are arranged symmetrically on the left and right sides of the box body The inner side of body 1. The halogen lamp 4 provides strong light, and the ultraviolet lamp tube 2 is used for sterilization. In order to improve the sterilization effect, two ultraviolet lamp tubes 2 are respectively installed on the inner walls of both sides of the box body 1 . Ob...
Embodiment 1
[0032] The kit of the present invention includes a Salmonella positive control, a Salmonella negative control, Taq premixed enzyme and primer mixture of appropriate concentration, DL Marker 2000, EMA solution of appropriate concentration and a covalent cross-linking exposure device. The premixed enzyme is 20u / mL, the primer concentration is 100pmol / mL, and the storage condition is -20°C. The sequences of the primers are: SE-1: GTGAAATTATCGCCACGTTCGGG SE-2: CATCGCACCGTCAAAGGAAC. EMA solution, its concentration is 0.5mg / mL.
[0033] Method of the present invention comprises the steps:
[0034] 1) Enrich the feed sample with BPW broth, pipette 500ul of bacterial suspension into four 1.5mL centrifuge tubes respectively, two of which are prepared as live cell bacterial suspension, and prepare two of them in a 100°C water bath for 10 min into a dead cell suspension. Take one part of the live cell suspension and one part of the dead cell suspension, add 4ul 0.5mg / mL hexidine azide...
Embodiment 2
[0039] The kit includes a Salmonella positive control, a Salmonella negative control, Taq premixed enzyme and primer mixture at an appropriate concentration, DL Marker 2000, an EMA solution at an appropriate concentration, and a covalent cross-linking exposure device. The premixed enzyme is 20 u / mL, the primer concentration is 100 pmol / mL, and the storage condition is -20°C. The sequences of the primers are: SE-1: GTGAAATTATCGCCACGTTCGGG SE-2: CATCGCACCGTCAAAGGAAC. EMA solution, its concentration is 0.5mg / mL.
[0040] Detection method of the present invention comprises the following steps:
[0041] 1) Take 2 parts of the sterilized blank concentrated feed and compound feed, add 1 CFU of Salmonella per 25 grams, enrich the bacteria in the sterilized BPW broth, draw 500ul of the bacterial suspension into four 1.5mL centrifuge tubes, Add 4ul 0.5mg / mL hexidine azide bromide solution to two of the centrifuge tubes respectively, place the centrifuge tubes on the ice box, and expose ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com