Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer

An oligonucleotide and mir-bart7 technology, applied in gene therapy, drug combination, antineoplastic drugs, etc., to achieve high transfection efficiency, high specificity, and prolonged action time

Inactive Publication Date: 2012-08-22
SOUTHERN MEDICAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Importantly, so far, there is still no report on the role of Epstein-Barr virus miR-BART7 and other Epstein-Barr virus miRNAs in promoting the development of nasopharyngeal carcinoma, especially the invasion and metastasis of nasopharyngeal carcinoma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer
  • Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer
  • Application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Preparation of nasopharyngeal carcinoma cell line CNE1 containing EBV-miR-BART7

[0033] Cells: CNE1 cell line, purchased from the Central Laboratory of Xiangya School of Medicine, Central South University, Hunan.

[0034] Oligonucleotide: The sequence of Epstein-Barr virus miR-BART7 antisense oligonucleotide is SEQ ID NO: 1, which was synthesized by Shanghai Gemma Pharmaceutical Technology Co., Ltd.

[0035] Preparation of CNE1 cells overexpressing EBV-miR-BART7: chemically synthesized Epstein-Barr virus miR-BART7 precursor molecular sequence (282bp), connected to the lentiviral vector pMAGic 4.0 containing GFP expression, and passed the pNL-EGFP / CMV / WPREDU3 vector plasmid , pCD / NL-BH*DDD packaging plasmid and pLTR-G plasmid were packaged in 293T cells to produce a lentiviral vector pMAGic-EBV-miR-BART7 capable of expressing EBV-miR-BART7. This lentiviral vector was used to transfect nasopharyngeal carcinoma cell line CNE1, and it was confirmed by flow cytometry an...

Embodiment 2

[0058] 1. Preparation of Nanospheres

[0059] 1.1. Preparation of polyethyleneimine-coated gold nanoparticles

[0060] Add the sulfhydryl-containing nano-gold to the NaCl solution with a concentration of 1 mM, and adjust the nano-gold concentration to 0.1 mg / ml; add polyethyleneimine (PEI, Mw=2k) to the reaction solution until the polyethyleneimine concentration is 1.0 mg / ml ml, react at room temperature for 30 minutes, centrifuge at 157500×g for 10 minutes, repeat twice to prepare polyethyleneimine-coated gold nanoparticles; resuspend the polyethyleneimine-coated gold nanoparticles in NaCl solution with a concentration of 10 mM to obtain 0.1 mg / ml Polyethyleneimine-wrapped nano-gold NaCl solution for use;

[0061] Wherein the nano-gold containing sulfhydryl group can be prepared according to the following method:

[0062] Take 100ml of chloroauric acid aqueous solution (0.01%), heat it to boiling, add 2.5ml of 1% trisodium citrate aqueous solution accurately under stirring...

Embodiment 3

[0088] Take 40ml of the 0.1mg / ml loaded antisense oligonucleotide nanosphere NaCl solution prepared in Example 2, concentrate it to 500μl by centrifugation, mix it with 500μl of 10mM sterile NaCl aqueous solution, add an appropriate amount of preservatives and stabilizers, and prepare as The concentration is 4mg / ml injection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to a medicine application of Epstein barr (EB) virus miR-BART7 antisense oligonucleotide, in particular to an application of EB virus miR-BART7 antisense oligonucleotide in preparing medicine capable of treating nasopharynx cancer. The antisense oligonucleotide has a sequence of CCCUGGACACUGGACUAUGAUG (SEQ ID NO:1). The antisense oligonucleotide disclosed by the invention can be effectively combined with the mature mi ribonucleic acid (RNA) of the EB virus to block EB virus miR-BART7 expression and the corresponding regulation action of the EB virus miR-BART7 so as to prevent the nasopharynx cancer cell from invading and transferring. The miRNA does not have immunogenicity and is favorable for further use for preventing the nasopharynx cancer from recurring and transferring. According to the medicine which embodies the application disclosed by the invention, the antisense oligonucleotide can be prevented from degrading by nuclease, the action time is prolonged, and the medicine has higher transfection efficiency than a commercial liposome and is favorable for further clinic practical development and application.

Description

technical field [0001] The present invention belongs to the field of compounds containing two or more mononucleotide units, in particular to compounds having a single phosphate group or polyphosphate group linked by a saccharide group of a nucleoside group. Background technique [0002] Nasopharyngeal carcinoma (NPC) is a common head and neck malignant tumor in southern my country. It is the disease with the highest recurrence rate and metastasis rate among head and neck tumors. The cervical lymph node metastasis rate is as high as 80%. 30% of patients experience nasopharyngeal carcinoma recurrence and metastasis, which is one of the main factors leading to clinical death. Traditional treatment methods such as surgery, radiotherapy or chemotherapy are not effective in preventing and treating nasopharyngeal carcinoma recurrence and metastasis. , the application of biological therapy is more suitable for the second stage of treatment, in which gene therapy has more important cli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K9/14A61P35/00
Inventor 李欣王莺蔡红兵蔡隆梅叶艳芬袁存存
Owner SOUTHERN MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap