Pig 4-1BB receptor, gene for encoding pig 4-1BB receptor and application thereof
A receptor gene and gene technology, applied in the field of porcine 4-1BB receptor, can solve the problem that the function of the coding sequence protein has not been reported.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 14-1B
[0025] Cloning of embodiment 14-1BB gene
[0026] The invention is based on the relatively high similarity of human and pig gene sequence comparison results, and designs primers according to human 4-1BB sequence, and uses Wuzhishan pig cDNA as a template to obtain the pig 4-1BB suspected sequence. The specific operation steps are:
[0027] (1) By comparing with the human 4-1BB gene sequence, find a gene segment with high similarity in the pig genome, and design primers accordingly (see Table 1: P1 and P2).
[0028] (2) Extraction of porcine peripheral blood mononuclear cells (PBMC) cDNA:
[0029] Aseptically take 20ml of heparin sodium anticoagulant blood from the anterior vena cava of a pig, dilute and mix it with equal volume of PBS, and slowly add it to an equal volume of porcine lymphocyte separation medium (Tianjin Haoxiang, China), with a horizontal rotor Centrifuge at 1800rpm for 20min. Afterwards, the lymphocyte layer under the plasma was aspirated to obtain PBMC. ...
Embodiment 2
[0039] Example 2 Effect of Upregulated Expression of Pig 4-1BB Gene on Pig T Cell Immune Response
[0040] Using the strategy provided by the present invention, the plasmid containing the porcine 4-1BB gene is transfected into porcine peripheral blood mononuclear cells (PBMC, mainly comprising T lymphocytes), and the activation of cells when it is stimulated by antigen (PRRSV) is detected at the cellular level and cytokine secretion activity.
[0041] (1) Construction of eukaryotic expression vector pMax-4-1BBHA. Design upstream primer: 5′(Kpn 1) GGTACCATGGGAAATGGCTACTACAA 3' and downstream primers: 5' (Sac1) CGAGCTCTCA TAG TTCACACTCGCCTTCCT 3' (the frame part is the HA tag sequence), using the cloning vector pEASY-4-1BB-2 containing the 4-1BB gene as a template, amplified the open reading frame fragment of porcine 4-1BB variant 2.
[0042] The reaction system and procedure are the same as Step 3 in Example 1. Both ends of the cloned fragment contain Kpn1 and Sac...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com