Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Osteoporosis susceptible gene non-invasive detection kit

A technology of osteoporosis and detection kit, applied in the field of molecular biology, can solve problems such as acceleration of osteoporosis

Inactive Publication Date: 2012-07-04
解码(上海)生物医药科技有限公司
View PDF0 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The risk of osteoporosis in women is higher than that in men. Although most bone loss begins before menopause, it can also accelerate osteoporosis due to the decline in estrogen levels during perimenopause

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Osteoporosis susceptible gene non-invasive detection kit
  • Osteoporosis susceptible gene non-invasive detection kit
  • Osteoporosis susceptible gene non-invasive detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1. Use of detection kits

[0023] 1. Extract DNA template

[0024] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0025] 2. PCR amplification reaction

[0026] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0027] (1) IL-6 (G-174C) forward primer: 5′CAAGACATGCCAAAGTGCTGA 3′

[0028] IL-6 (G-174C) reverse primer: 5′ATCTTTGTTGGAGGGTGAGGG 3′

[0029] (2) VDR (Bsm I) forward primer: 5'CACGGAGAAGTCACTGGAGG3'

[0030] VDR (Bsm I) reverse primer: 5'TCTCATTGCCAAACACTTCG3'

[0031] (3) VDR (TaqI) forward primer: 5'AATACCTACTTTGCTGGTTTGC3'

[0032] VDR (TaqI) reverse primer: 5'CTCCCTCTTCTCACCTCTAACC3'

[0033] (4) TNF-a (G-308A) forward primer: 5'GGAAGCCAAGACTGAAACCA3'

[0034] TNF-a (G-308A) reverse primer: 5'TCATCTGGAGGAAGCGGTAG3'

[0035] (5) OPG (Lys3Asn) forward primer: 5'CTGTTGCCGGGACGCTAT3'

[0036] OPG (Lys3Asn) r...

Embodiment 2

[0054] Example 2. Services for non-invasive detection of osteoporosis prevention genes for people

[0055] 1. Sampling and DNA extraction

[0056] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0057] 2. Genotype detection

[0058] Using the kit provided by the invention, the IL-6 gene G-174C (rs1800795) of the subject's genomic DNA, BsmI (rs731236) and TaqI (rs1544410) on the VDR gene, G-308A (rs1800629) on the TNF-a gene ), the five single nucleotide polymorphism sites of Lys3Asn (rs2073618) on the OPG gene were subjected to DNA sequencing respectively, and the genotypes of these five SNPs sites were determined.

[0059] 3. Risk assessment of women at high risk of osteoporosis

[0060] Through the analysis of the SNPs genotype of the subjects, an osteoporosis risk assessment and analysis report is issued. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a non-invasive detection kit for detecting susceptible genes of women osteoporosis. The kit comprises five osteoporosis single nucleotide polymorphism genotype specific primers, a DNA sequencing primer, a polymerase chain reaction (PCR) reaction component, a PCR product purification component, a DNA sequencing reaction component and the like, wherein the five osteoporosis single nucleotide polymorphism genotype specific primers are used for detecting G-174C on an IL-6 gene, BsmI and TaqI on a VDR gene, G-308A on a TNF-a and Lys3Asn on an OPG gene. The kit can screen out high-risk women group susceptible to osteoporosis by detecting the genotypes of the five osteoporosis single nucleotide polymorphisms closely related to osteoporosis, can evaluate the risk level susceptible to osteoporosis from gene level according to the gene detection result of every checked person and can guide menopausal women to effectively prevent osteoporosis.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a female osteoporosis susceptibility gene detection kit, which evaluates the risk level of female osteoporosis susceptibility from the genetic level according to the detection results, and serves as A guide to recommendations for the prevention of osteoporosis. Background technique [0002] Osteoporosis is a metabolic bone disease characterized by decreased bone mass and microarchitectural destruction of bone tissue, leading to increased bone fragility and susceptibility to fracture. It is one of the most serious degenerative diseases. Osteoporosis can easily lead to bone pain, bone disease, and fractures, directly affecting the quality of life of middle-aged and elderly people, and has become a public health problem. The risk of osteoporosis in women is higher than that in men. Although bone mass loss mostly begins before menopa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com