Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Receptor-like protein kinase gene, and expression vector and application thereof

A technology of receptor protein and expression vector, applied in the field of genetic engineering, can solve problems such as loss of resistance to powdery mildew and rapid change of pathogenic bacteria species

Active Publication Date: 2012-07-04
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most economical and effective way to control powdery mildew is to use disease-resistant varieties, but due to the rapid change of pathogenic bacteria races, some existing varieties in my country have gradually lost their resistance to powdery mildew

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Receptor-like protein kinase gene, and expression vector and application thereof
  • Receptor-like protein kinase gene, and expression vector and application thereof
  • Receptor-like protein kinase gene, and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Cloning of a receptor-like protein kinase gene induced by powdery mildew in wheat IGVI465 containing Pm6 in embodiment 1

[0023] The fine mapping of Pm6 has been completed in the early stage of this study. On the basis of fine mapping, a comparative genomics study was carried out on the area where Pm6 is located, Brachypodium and rice, and it was found that wheat, rice, and Brachypodium had good collinearity in the area where Pm6 was located (Bi Qin, Aizhong Cao et al. al. Collinearity-based marker mimng for the fine mapping of Pm6, a powdery mildew resistance gene in wheat. Theor Appl Genet. 2011, 123: 201-218). In this study, a leucine-rich receptor-like protein kinase gene (LRR-RLK) was predicted in Brachypodium and rice genome sequences that were colinear with the Pm6 region, and it was also predicted to exist in the Pm6 region of wheat IGVI465 A gene homologous to receptor-like protein kinase gene in model species, this gene may be a candidate gene of Pm6 gene. ...

Embodiment 2

[0029] The construction of embodiment 2 TaLRR-RLK2 gene transient expression vector

[0030] With the TaLRR-RLK2 gene cDNA cloned in IGVI465 induced by powdery mildew as a template, the primer pair RLK-ATG-BamHI-F (CGGGATCCATGGGGCGGAGGAGGCA, SEQ ID NO.11) and RLK-TGA-KpnI-R (GGGGTACCTCAACGGCCTTCGTCCA, SEQ ID NO.12) Carry out PCR amplification, and recover the amplified fragment. The amplified product was double digested with BamHI and KpnI, and the digested product was inserted into the vector pBI220 ((Jefferson RA, Kavanagh TA, Bevan MW.GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6: 3901-3907.)), put TaLRR-RLK2 at the multiple cloning site behind the 35S promoter. Thus, the target gene TaLRR-RLK2 was cloned to the downstream of the strong promoter 35S to obtain the expression vector pBI220: Ta-LRR-RLK2 ( figure 1 ). It was verified by sequencing that the vector was constructed successfully.

Embodiment 3

[0031] Example 3 Transfer of TaLRR-RLK2 gene into wheat leaves by transient expression method

[0032] The transient expression method is a reliable and rapid method for identifying gene functions (Schweizer, Pokorny et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-Microbe Interactions. 1999, 12: 647-654.) . In this study, the transient expression method was used to wrap the plasmid DNA on the outer layer of metal particles, and the metal particles and genes were bombarded into the epidermal cells of wheat leaves with the help of a gene gun. The powdery mildew haustoria index of RLK2 cells, to clarify whether the target gene has powdery mildew resistance function.

[0033] The procedure for encapsulating carrier DNA and metal particles is as follows:

[0034] Preparation of tungsten powder: Weigh 30mg of tungsten powder into a 1.5ml eppendorf tube, add 1ml of 70% alcohol, vortex for 3-5min and then let stand for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering, and discloses a receptor-like protein kinase gene, and an expression vector and application thereof. The cDNA sequence of the receptor-like protein kinase gene TaLRR-RLK2 is shown as SEQ ID NO.1, and an ammonia acid sequence coded by the gene is shown as SEQ ID NO.2. The gene comes from a Triticum aestivum L. Prins-T. timopheevi Zhuk introgression line IGVI465, and is reported in wheat for the first time. The gene transforms susceptible wheat variety Prins through transient expression, and a result shows that the over-expression of the TaLRR-RLK2 can reduce the haustorium index of the Prins. Therefore, the TaLRR-RLK2 can be expected to be used for genetically engineered breeding, and can improve the powdery mildew resistance of wheat after the gene is transferred into a powdery mildew susceptible wheat variety.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a receptor-like protein kinase gene, its expression carrier and application. Background technique [0002] Wheat powdery mildew is a fungal disease caused by wheat powdery mildew (Blumeriagraminis f.sp.tritici). Wheat powdery mildew used to mainly occur in cold, humid, and rainy areas. In recent years, it has gradually increased from south to north, which has brought more and more serious harm to wheat production. In the year when powdery mildew occurs, wheat can be Severe production cuts. The most economical and effective way to control powdery mildew is to use disease-resistant varieties. However, due to the rapid change of pathogenic species, some existing varieties in my country have gradually lost their resistance to powdery mildew. The isolation and identification of new powdery mildew resistance genes, the use of genetic engineering to transfer into susceptible varieties, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/63C12N15/82A01H5/00
Inventor 陈婷婷覃碧曹爱忠王海燕邢莉萍肖进刘洋洋王秀娥
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com