Gene combination, primer and probe for detecting susceptibility to type I diabetes mellitus and application
A gene combination and diabetes technology, applied in the field of probes and uses, primers, and gene combination to detect the susceptibility of type I diabetes, can solve problems such as bad living habits and changes, and achieve high sensitivity, good repeatability and high accuracy. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0026] The invention is a gene combination for detecting the susceptibility of type I diabetes, which includes the combination of three genes closely related to type I diabetes: PTPN22 gene, CTLA-4 gene and VDR gene. Including the following SNP sites: rs2476601 site of PTPN22 gene, rs231775 site of CTLA-4, rs2228570 site of VDR.
[0027] The gene combination used to detect susceptibility to type I diabetes is used to design specific primer pairs and probes for the site.
[0028] The primers described in the present invention are designed for the rs2476601 site of the PTPN22 gene, the rs231775 site of CTLA-4, and the rs2228570 site of the VDR, and can be used for multiplex PCR amplification, and can amplify the above three sites at the same time. Gene fragment. Designing such primers is readily accomplished by those skilled in the art. Preferably, the primers described in the present invention have the following sequence:
[0029] For rs2476601 site: AACTGCTCCAAGGATAGATG
...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap