Supercharge Your Innovation With Domain-Expert AI Agents!

Joint connection-based deoxyribonucleic acid (DNA) polymerase chain reaction (PCR)-free tag library construction method

A technology of linker connection and construction method, which is applied in the direction of DNA/RNA fragmentation, DNA preparation, recombinant DNA technology, etc., can solve the problems of low PCR amplification efficiency, small number of tags, and high cost, and achieve increased sequencing throughput, The effect of reducing the cost of sequencing and improving the recognition rate

Active Publication Date: 2011-02-09
BGI TECH SOLUTIONS
View PDF3 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are some defects in the method for preparing the tag library provided by Illumina: first, at present, Illumina only provides 12 tag sequences with a length of 6 bp, and the number of tags is small. Mixed sequencing of samples will be a huge defect; second, the current label library construction method provided by Illumina is to import the label sequence into the target fragment library through PCR reaction, which requires 3 PCR primers to amplify the target fragment (two Common primers and a PCR index primer, as shown in Table 1), and the PCR amplification efficiency is not high
Third, the linker in the label library construction method provided by illumina does not contain the label sequence. Each label library needs to pass a PCR reaction to import the label sequence, and then needs to cut the gel for each label library. Tagged target fragment libraries are then pooled, which is not only time-consuming, but also expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Joint connection-based deoxyribonucleic acid (DNA) polymerase chain reaction (PCR)-free tag library construction method
  • Joint connection-based deoxyribonucleic acid (DNA) polymerase chain reaction (PCR)-free tag library construction method
  • Joint connection-based deoxyribonucleic acid (DNA) polymerase chain reaction (PCR)-free tag library construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0868] Example 1: DNA labeling experiment library construction method specific

[0869] 1.1 DNA template preparation

[0870] Using the plasmid pMD18-T (Japanese takara) as a template, use Primer Premier5.0 software to design primers, PCR amplified fragments with a length of 250bp, use the NanoDrop 1000 instrument (U.S. NanoDrop) to detect the concentration of the amplified product, and then take according to the concentration. 1ug of this PCR product was used as an insert for library construction, and water was added to make the volume to 35 μL. PCR primer sequences:

[0871] pMD18-T primer 1: CGGGGAGAGGCGGTTTGCGTATTGG;

[0872] pMD18-T Primer 2: TTTTGTGATGCTCGTCAGGGGGGCG.

[0873] 1.2 End repair [6]

[0874] Prepare the reaction mix in the following proportions:

[0875] pMD18-T plasmid DNA template 35μL

[0876] T4 DNA Ligase Buffer 50 μL

[0877] dNTPs mixture 4 μL

[0878] T4 DNA polymerase 5 μL

[0879] Klenow DNA polymerase 1 μL

[0880] T4 polynucleotide kina...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention designs 161 unique tag sequences with the lengths of 8 bp. Tags are embedded into a deoxyribonucleic acid (DNA) joint so as to form a DNA polymerase chain reaction (PCR)-free tag joint. The invention also provides a DNA tag library which introduces the tag sequence by connecting the DNA PCR-free tag joint without a PCR and is applied to solexa DNA sequencing. After a library construction method is optimized, the DNA tag library is constructed without the PCR.

Description

technical field [0001] The invention relates to the technical field of nucleic acid sequencing, in particular to the technical field of DNA PCR-Free tag library based on linker ligation. In addition, the present invention also relates to labeling technology and a method for realizing library construction of multiple samples in the same reaction system. The method of the present invention is particularly suitable for the second generation sequencing technology, especially the solexa sequencing technology. Background technique [0002] The Solexa DNA sequencing platform provided by Illumina can simultaneously add four kinds of fluorescently labeled nucleotides in one reaction, and adopts Sequencing By Synthesis (SBS), which requires less sample volume and high throughput. High accuracy, with the characteristics of simple and easy-to-operate automation platform and powerful functions [1-4]. Library construction first needs to perform end repair on the target fragment, connect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B40/06C12N15/11C40B50/06
CPCC12N15/1065C40B50/08C40B40/06
Inventor 章文蔚田方陈海燕于竞龚梅花张艳艳周妍
Owner BGI TECH SOLUTIONS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More