Expression plasmid adjuvant for enhancing chemotherapeutic effect of tumor chemotherapeutics and preparation method thereof
A chemotherapeutic drug and plasmid technology is applied in the field of biomedicine to achieve the effects of improving sensitivity, improving chemotherapeutic effect and enhancing chemotherapeutic effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1: Construction of recombinant plasmid PKLO-anti-miR23a
[0031] Design expression miR-23a inhibitor sequence with neck loop structure:
[0032] Sense strand: 5′ CCGGTATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGATTTTTTG 3′
[0033] Antisense strand: 5′AATTCAAAAAATCACATTGCCAGGGATTTCCCTCGAGGGAAATCCCTGGCAATGTGAT A 3′
[0034] Add cohesive ends that can match the end of the carrier and bind the enzyme cleavage site at both ends of the sequence, artificially synthesize the sequence with the neck loop structure, and resuspend the nucleotide sequence in double distilled water at a concentration of 1ug / ul. This tube nucleotide sequence is annealed into a duplex.
[0035] The annealing system is:
[0036] -5ul of Sense oligo
[0037] -5ul of Antisense oligo
[0038] -5ul of 10x NEB buffer 2
[0039] -35ul ddH2O
[0040] A total of 50ul of the system was incubated in a 95°C water bath for 4 minutes, in a beaker filled with 1500ml of water at 70°C for 10 minu...
Embodiment 2
[0041] Example 2: Large-scale preparation of the recombinant plasmid PKLO-anti-miR23a (using the plasmid large-scale extraction kit of Beyond Biotechnology Co., Ltd.)
[0042] 1. Take the overnight bacteria into a 50ml centrifuge tube, centrifuge at 5000g for 1 minute to collect the bacterial pellet, and discard the supernatant. Repeat again and collect a total of 100 mL of overnight bacterial pellet per tube.
[0043] 2. Add 5ml solution I to each tube to resuspend the bacterial pellet. Make sure the pellet is completely dispersed with no visible clumps of bacteria. Confirm that RNase A has been added to Solution I. Vortex at top speed for 10-20 seconds or more to suspend the pellet. It must be fully mixed, and it should be a uniform suspension when observed against a bright place, without obvious bacterial agglomerates or flocs. If there is no vortex instrument, you can blow the sediment with a gun to gradually disperse the sediment.
[0044] 3. Add 5 ml of solution II ...
Embodiment 3
[0057] Example 3: PLKO-anti-miR23a enhances the chemotherapy effect of chemotherapy drug 5-FU on colon cancer xenografts
[0058] 1. Establishment of xenograft model of human colon cancer cell line HCT116:
[0059] Will collect 1×10 7 HCT116 cells (purchased from the Chinese Academy of Sciences Cell Bank) were resuspended in serum-free medium and inoculated subcutaneously on the right back of 6-8 week immunodeficient mice. Tumors grew out 10 days after inoculation. 3 , the mice were randomly divided into three groups. A: Tail vein injection of 60 μl / monkey with PBS; B: tail vein injection of 60 μl / mouse of 5-FU+intratumoral injection of PLKO.1 empty plasmid; C: tail vein injection of 60 μl / mouse of 5-FU+intratumoral injection of PLKO-anti-miR23a expression plasmid.
[0060] Measure the length and width of the tumor every week, and apply the formula V=0.4×LW 2 To calculate the tumor volume, the plasmid and chemotherapy drug 5-FU were injected into the tail vein once a week....
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com