Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing recombinant phosphinthricin acetyltransferase (PAT)

A technology of phosphinothricin and transferase, which is applied in the biological field and can solve the problems of insufficient safety evaluation data

Inactive Publication Date: 2012-06-20
CHINA NAT RICE RES INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the disadvantage is that the recombinant protein expressed in Escherichia coli often exists in the form of insoluble non-functional inclusion bodies due to overexpression, environmental stress, interference with the host metabolic system, etc.
However, there are very few detailed safety evaluation data for the expression product of bar gene, and its safety evaluation has become the key to restricting the large-scale promotion of transgenic plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant phosphinthricin acetyltransferase (PAT)
  • Method for preparing recombinant phosphinthricin acetyltransferase (PAT)
  • Method for preparing recombinant phosphinthricin acetyltransferase (PAT)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Design and synthesis of oligonucleotide primers

[0043] A pair of primers was designed based on the full-length nucleotide sequence of the bar gene,

[0044] Upstream primer bar1: CG GGATCC ATGAGCCCAGAACGACGC, the 5'end is designed with BamHI restriction endonuclease sequence (underlined part), and its nucleotide sequence is shown in SEQ No.1;

[0045] Downstream primer bar2: CCC AAGCTT ATCAAATCTCGGTGACGGGCAGG, 3'end is designed with HindIII restriction endonuclease sequence (underlined part), and its nucleotide sequence is shown in SEQ No.2.

Embodiment 2

[0046] Example 2: PCR amplification of the target fragment of bar gene

[0047] Using the plasmid pDsBar 1300 total DNA as a template, primers bar1 and bar2 were used to amplify the bar gene sequence. The PCR reaction system is: 10×Taq reaction buffer 2.5μL, 25mMMgCl in a total volume of 25μL 2 , 2.5mM dNTP, 10μM primer bar1, 10μM primer bar2, plasmid DNA 100ng, 0.5UTaq DNA polymerase, add ddH 2 O make up the volume to 25 μL. PCR reaction conditions are: 94°C pre-denaturation for 4 minutes; 94°C denaturation for 50s, 55°C annealing for 50s, 72°C extension for 50s, a total of 30 cycles; after the end of the cycle, 72°C extension for 10 minutes, the PCR amplification results are as follows figure 1 Shown. The results showed that the PCR amplified product of the bar gene had a specific band between 500 and 750 bp, which was consistent with the expected result.

Embodiment 3

[0048] Example 3: Construction and sequence determination of recombinant vector

[0049] The PCR product is separated by 1% agarose electrophoresis and the target fragment is recovered. The purified PCR product and the prokaryotic expression vector pET30a(+) are respectively subjected to BamHI and HindⅢ digestion treatment, and the target fragment with double sticky ends and expression are respectively recovered Carrier. Under the action of T4 ligase, ligate at 16°C for 3 hours to construct the prokaryotic expression plasmid pET30a(+)-bar, such as figure 2 Shown. Transform the recombinant plasmid into E.coli DH5α competent cells, pick the positive clones, extract the plasmid, and perform double enzyme digestion for identification, such as image 3 Shown. The recombinant plasmid DNA has specific target gene bands and pET30a(+) DNA vector bands between 500~750bp and 4361~6557bp, which are consistent with the expected results. Select positive clones and submit them to Shanghai Bi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for preparing recombinant phosphinthricin acetyltransferase (PAT), and belongs to the technical field of biology. The method comprises the following steps of: 1) designing a bar gene PCR primer and performing PCR amplification to obtain a bar gene; 2) building a recombinant plasmid pET30a(+)-bar; 3) building engineering bacteria BL21 / pET30a(+)-bar; 4) performing fermentation culture to obtain a specific expressed protein; 5) increasing the solubility of the specific expressed protein; 6) separating and purifying a PAT crude product; and 7) preserving. The method has reasonable design; a large number of high-purity and soluble recombinant PAT can be quickly obtained by the method; and the PAT serving as an antigen can be used for preparing a monoclonal antibody and performing qualitative and quantitative detection on PAT-containing transgenic products, and can lay the foundation for screening of effective antigens, development of diagnostic reagents and safety evaluation of transgenic crops.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a method for obtaining recombinant phosphinothricin acetate transferase by bioengineering technology, including the cloning of bar gene, the construction method of recombinant plasmid, the fermentation expression method of engineering bacteria, and the recombinant phosphinothricin Separation and purification method of acetophthalotransferase. Background technique [0002] With the commercial production of genetically modified crops, the safety of their products and whether they have an impact on the ecological environment has aroused widespread concern. Many countries require that genetically modified products must be labeled before they go on the market through legislation or other forms. The testing of genetically modified products has been included in the testing items of domestic and foreign inspection and quarantine departments. [0003] The detection of genetically modifie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/70C12N1/21C12N9/10C12R1/19
Inventor 王玲刘连盟黄世文
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More