Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection
A technology of real-time fluorescence and detection methods, which is applied in the directions of fluorescence/phosphorescence, measurement/inspection of microorganisms, biochemical equipment and methods, etc., to shorten the detection time and increase the accuracy of identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] 1. Design Primers and Probes
[0032] According to the sequences of part of the cob-nadh1 gene in the mtDNA (mitochondrial DNA) of Bactrocera dorsalis, B. papaya, B. carambola and B. philippines (GenBank numbers: DQ917577, DQ917578, EF014414, DQ995281) Design the following specific primers G-FP / RP and probe G-MGB (primers and probes are synthesized by Shanghai Jikang Company):
[0033] Upstream primer G-FP: 5'-CGGGCTGTGGCACAAACTAT-3';
[0034] Downstream primer G-RP: 5'-AACTCCGATTCACCTTCTGCAA-3';
[0035] Ceratitis philippines probe G-MGB: FCATTAGTTTTATTATCCTTTGTATTTP
[0036] The detection principle of the above primers and probes is as follows: figure 1 As shown, four kinds of fruit flies (Bactrocera philippines DQ995281, Bactrocera dorsalis DQ917577, Bactrocera carambola EF014414, Bactrocera papaya DQ917578) sequence alignment at the probe positions are shown in figure 2 .
[0037] 2. Extraction of Ceratitis philippines DNA
[0038] Take a sample of Bactrocera...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap