Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, vector containing same and application thereof

A ligase and carrier technology, applied in DNA/RNA fragments, applications, gene therapy, etc., can solve the problems of high price of interfering RNA, short duration of action, poor interference effect, etc., to prevent and treat muscle atrophy, enhance, Long-lasting effect and good targeting effect

Inactive Publication Date: 2012-10-10
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to being expensive, chemically synthesized interfering RNA has poor targeting, low specificity, and short duration of action, resulting in poor interference effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, vector containing same and application thereof
  • Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, vector containing same and application thereof
  • Interference RNA interfering muscle specific E3 ubiquitin protein ligase gene, vector containing same and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1, design of interfering RNA sequence targeting Atrogin-1 gene, vector construction and cell Pharmacodynamic testing at cellular and animal levels.

[0064] 1. Sequence design of interfering RNA inhibiting Atrogin-1 gene expression and construction of expression vector

[0065] 1. Design of interference RNA sequence

[0066] (1), design of the interfering RNA sequence targeting the 3' end of the Atrogin-1 gene

[0067] Using interference sequence design software ( siRNA design ) to design the interfering RNA sequence targeted at the 3' end of the Atrogin-1 gene (SEQ ID NO: 7): the designed DNA sequence corresponding to the interfering RNA is as follows figure 1 B, The interfering sequences are all homologous to human and mouse, and can form a small hairpin structure after transcription, so that they can be successfully recognized and cut by dicer enzyme, and lead to the degradation of mRNA. Taking the sequence of Atrogin-3'-1 as an example, its ...

Embodiment 2

[0116] Example 2, Design of Interfering Sequence Targeting MuRF 1 Gene, Vector Construction and Cell and Animal Methods Ping pharmacodynamic testing.

[0117] 1. Construction of an interfering RNA gene expression vector that inhibits MuRF 1 gene expression

[0118] 1. Design of interference RNA sequence

[0119] (1), design of the interfering RNA sequence targeting the 3' end of the MuRF 1 gene

[0120] Use the interference sequence design software to design the RNA interference sequence targeting the 3' end of the MuRF1 gene (SEQ ID NO: 8), the DNA sequence of which is as follows:

[0121] M-3’-1 5’TCGAAAAAAGGACAGATGAGGAGGAGGATCAACAG

[0122] TCCTCCTCCTCATCTGTCCTTTTT3' (SEQ ID NO: 4)

[0123] In the following description, M-3'-1 siRNA is referred to as siRNA for short in Example 2

[0124] (2) Design of interfering RNA sequence targeting the 5' end of MuRF 1 gene

[0125] Method is with embodiment 1.

[0126] M-5'-1:

[0127] 5'GATCAAAAATGGAGAACCTGGAGAAGCAT...

Embodiment 3

[0159] Example 3: Construction of a combined vector targeting Atrogin-1 and MuRF 1, at the cellular level and in animals Level pharmacodynamic testing.

[0160] 1. Construction of bivalent interfering RNA carrier

[0161] The above-mentioned interference fragment expression cassettes (H1+siRNA+U6) targeting the 3' end, 5' end and the middle region of the Atrogin-1 gene and the MuRF 1 gene that have been proven to be effective were respectively extracted from the recombinant vector PDC312+H1+siRNA+U6 Excised (taking A-3'-1 (SEQ ID NO: 1) and M-3'-1 (SEQ ID NO: 4) as examples), the expression cassettes were filled with Klenow fragments, respectively, and synthesized The enzyme-cut linkers XbaI, SalI, EcoRI, and BamHI were connected, and connected to the corresponding sites of the adenovirus PDC312 vector. Sent for sequencing, the adenovirus vector A-3'-1+M-3'-1 was successfully constructed.

[0162] 2. Pharmacodynamic detection of interfering RNA

[0163] (1) Pharma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for interfering muscle specific E3 ubiquitin protein ligase gene expression, in particular to interference RNAs of an Artogin-1 gene and a MuRF1 gene and DNA sequences thereof, a carrier containing the same and the interference RNAs transcribed by the carrier, and application of the interference RNA sequences, the carrier containing the same and the interference RNAs transcribed by the carrier to preparing a medicine for preventing and treating amyotrophy diseases. In cellular levels and experimental animals, the interference RNA sequences of the invention respectively lower Atrogin-1 gene expression and MuRF1 gene expression by about 60% and 30% compared with contrast, and muscular cell differentiation levels are respectively improved by about 70% and 30% compared with contrast. The interference RNAs show obvious treating effect on amyotrophy of experimental animals, thus effectively improving muscle quality in the event of an outbreak.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to interfering RNA for muscle-specific E3 ubiquitin protein ligase genes, specifically Atrogin-1 and MuRF1, a carrier comprising the interfering RNA, an interfering RNA transcribed from the carrier and its Application in preparation of medicine for preventing or treating muscle atrophy. Background technique [0002] "Muscle atrophy" refers to the shrinkage of skeletal muscle volume, reduction or thinning of muscle fibers or even disappearance. Various factors can lead to the occurrence of muscle atrophy, serious diseases such as hepatitis B, diabetes, AIDS, kidney failure and so on. One of the main manifestations of muscle atrophy is the loss of skeletal muscle proteolysis, which is degraded by 3 types of protease pathways: lysosomal proteases, calcium-dependent proteases and ubiquitin-proteases, the latter being the most important. Both Atrogin-1 and MuRF 1 belong to muscle-s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/861C12N15/63A61K31/7088A61K48/00A61P21/00
Inventor 刘长梅田波丛浩龙
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com