Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof

A technology of alleles and Chinese cabbage, applied in the field of characteristic sequence amplification markers, can solve the problems of inability to apply molecular markers to assisted breeding, complex detection methods, and long genetic distances

Inactive Publication Date: 2009-11-11
SHENYANG AGRI UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two markers are located on the same side of the target gene, the genetic distance is relatively long, and the detection method is complicated, so it cannot be applied to molecular marker-assisted breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof
  • SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. Acquisition of the Amplified Fragment Length Polymorphism (AFLP) Marker Linked to the Chinese Cabbage Genic Sterility Multiple Allele Ms

[0045] 1. Construction of Separation Groups

[0046] When AB01-1(MsMs) was used as the female parent and S02(msms) was crossed, all the F1 plants obtained were sterile. Then use S02 as the reincarnation parent to build BC 1 generational segregation groups. All 244 strains of BC sown 1 Among the generation individuals, 130 were fertile and 114 were sterile. Fertility segregation ratio conforms to 1:1(x 2 =0.922;x 2 005，1 = 3.84).

[0047] 2. Extraction of DNA

[0048] a. Add 500uL 1×CTAB extract (2%CTAB, 100mmol / L Tris-HCl, 20mmol / LEDTA, 1.4mol / LNaCl,) and 6uL β-mercaptoethanol to a 1.5ml centrifuge tube, shake well;

[0049] b. Take 0.2 g of young leaves, grind them to powder under liquid nitrogen conditions, add them to a centrifuge tube containing CTAB extract and β-mercaptoethanol, and shake well;

[0050] c. Th...

Embodiment 2

[0067] Example 2. Acquisition and Identification of SCAR Markers Linked to Multiple Alleles of GMS in Chinese Cabbage

[0068] 1. Transformation of SCAR markers

[0069] The DNA fragments of P01 and P04 were purified with low-melting point agarose, the purified DNA fragments were connected with PGEM-T easyVector (Promega), transformed into Escherichia coli, and the recombinant plasmids were detected by electrophoresis, and the obtained positive clones were sent to Sangon for sequencing. Homology analysis was performed on the obtained sequencing results with the GenBank international gene database, and no related gene sequence was found to be highly homologous to this fragment. The sequences of the two SCAR markers are:

[0070] (1) SCR 01 -378:

[0071] 5’-GCAAATTTGTCAAACTTCACCCTTGTACGGAAAAATGTTTGCGGCTTGACGTGGCTCGAGTTTCTCCAGAAGCCACTGGTGGAGAGGATCAGCTTCGCGGATAAGGATGGTGTGCAAGTGGTGATTGATGTATGCTACCCCTGGTTGCCTCCGAGATGCAATATTTGCAATGCTTGGGGCCACAAGGGAGAGGCATGTAATTCGAGGAAGATTAAGGTTCT...

Embodiment 3

[0083]Example 3, the application of two SCAR markers in the assisted selection of the multiple allele Ms with GMMS in Chinese cabbage

[0084] (1) Carry out the extraction of genomic DNA by the method in embodiment 1 to be tested material

[0085] (2) PCR amplification:

[0086] a. Reaction system: 25uL system, the content of each component is 20ng template; 2.5uL 10×Buffer; 1.6mM MgCl 2 ; 0.15mmol / L dNTP; 5pmol primer; 1.25U Tag DNA polymerase; ddH 2 O make up 25uL, mix well, and centrifuge;

[0087] b. Amplification program: pre-denaturation at 94°C / 4min, 94°C / 60s, 59°C / 60s, 72°C / 90s, after 30 cycles, extension at 72°C for 10 minutes;

[0088] c. Electrophoresis:

[0089] ①SCR 01 -378: Take 10uL of the amplification product and mix it with 2uL of 6×Loading buffer, point it into 1.5% agarose gel containing 0.5ug / ml EB, electrophoresis at 110V for 1 hour, and image it on the gel after staining with EB Observe and take pictures in the instrument.

[0090] ②SCR 02 -208: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides two SCAR marks including an SCR01-378 and an SCR02-208 which are positioned at two sides of a genetic sterile multiple allele Ms of a celery cabbage and are in tight linage with the genetic sterile multiple allele Ms. The genetic distances of the two marks and the MS gene are 1.2 centimeters and 2.5 centimeters respectively. According to the nucleotide sequences of the two marks, two pairs of specific amplification primers are designed respectively and are used for molecular-assisted selection of the genetic sterile multiple allele of the celery cabbage. The two marks are used simultaneously in the process of the molecular-assisted selection, and the selection accuracy is over 97.5 percent. The two marks have the advantages of good repeatability, high reliability, low detection cost, time conservation and labor conservation.

Description

technical field [0001] The invention relates to a characteristic sequence amplification (Sequence Characterized Amplified Region, SCAR) marker closely linked with the Chinese cabbage nuclear sterile multiple allele Ms and an obtaining method thereof. Background technique [0002] In 1991, our research group obtained 4 male sterile materials with 100% sterile plant rate, and found that the sterility of the sterile materials belonged to multiple allele inheritance, and then proposed "Chinese cabbage nuclear gene male sterility Yufu allelic inheritance hypothesis", which was confirmed by later experiments. Studies have shown that this sterility is controlled by three genes at one locus: "Ms" is the dominant sterility gene; "ms" is the allele recessive fertility gene of "Ms"; f " is the allelic dominant restorer gene of "Ms", and the explicit relationship between the three is Ms f > Ms > ms. The genotype of the sterile plants of the "dual-purpose line" formulated as a s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 冯辉魏鹏朴钟云刘志勇李承彧王玉刚冀瑞琴纪淑娟
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com