Porcine alpha interferon and interleukin 2 chimeric gene, construction method and protein purification method thereof
A technology of interleukin and alpha interferon, which is applied in the field of flexible gene connectors to achieve the effect of good prevention and control and simplified operation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0040] 1 method
[0041] 1.1 Design and synthesis of primers
[0042] The gene linker is a flexible linker rich in glycine (G) and serine (S) (G 4 S) 3 , a total of 15 amino acids. According to the sequence of the PoIFN-α gene in rpQE-30 / PoIFN-α (GenBank accession number: AB369102) and the sequence of the PoIL-2 gene in GenBank (AB194099), we designed 4 primers for SOE using Oligo6.0 software -PCR amplification, the sequence is as follows: P1:
[0043] 5′-TCA GCATGC TGTGACCTGCCTCAGACCC-3' (with SphI restriction site); P2:
[0044] 5′-
[0045] GCCACCGCCAGAGCCACCTCCGCCTGAACCGCTCCACCCTCCTTCTTCCTGAGTCTG-3′, the full length is 58bp, of which the partial linker length is 39bp, which is the downstream primer used to amplify the PoIFN-α-linker part of the PoIFN-α-linker-PoIL-2 chimeric gene; P3: 5′-GGCGGTTCAGGCCTGGAGGTGGCTCTGGCGGTGGCGGATCGGCACACCTACTTCA ', the upstream primer used to amplify the linker+PoIL2 part of the chimeric gene; P4: 5'-TAC GGATCC AGTCAGTGTTGAGTAGATGC-...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com