Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being
A totipotent stem cell, separation and purification technology, applied in the field of separation and purification of stem cells, can solve problems such as incomplete embryonic stem cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Isolation, purification, culture, proliferation and identification of totipotent stem cells from human early aborted fetal tissue
[0058] 1.1 Materials and methods
[0059] 1.1-1. Reagents
[0060] α-MEM medium (α-MEM), fetal calf serum (FCS) and trypsin-EDTA (trypsin-EDTA) solution were purchased from Invirogen (USA). Penic / streptomycin and amphotericin B, type I collagenase and goat anti-mouse antibody-HRP complex were purchased from Sigma (USA). Monoclonal antibodies against OCT-4, SSEA-1, SSEA-3, SSEA-4, TRA-1-60 and TRA-1-81 were purchased from R&D System (USA). Monoclonal antibodies against AFP, Nestin and SMA were purchased from Sigma (USA) and Dako (Denmark). The reverse transcription (RT) kit was purchased from Promega (USA); the DNA Taq enzyme kit was purchased from Qiogen (Germany). Primers for RT-PCR were synthesized by Invirogen.
[0061] 1.1-2. Collection of samples and isolation of fetal tissue cells
[0062] The fetal-placental tissues ...
Embodiment 2
[0096] Example 2: In vitro differentiation of stem cells---islet β-cells
[0097] 2.1 Materials and methods
[0098] 2.1-1. Reagents: Purchase phosphate buffered solution (PBS) from Invitrogen; α-minimallessential medium (α-MEM); Dulbecco modified Eagle's medium (DMEM); F12 medium, fetal calf serum (FCS); knockout serum; / Streptomycin; Amphotericin B; L-glutamin; 0.25% Trypsin-EDTA; B27-supplement, bFGF. Insulin, transferrin, selenium chloride, fibronectin and putrescine were purchased from Sigma. Anti-Insulin and Nestin anti-specific antibodies were purchased from Dako (Denmark). Insulin ELISA Kit was purchased from Abbott (USA).
[0099] 2-1-2. Methods: The method of directed differentiation of pancreatic islet β-cells mainly refers to the literature published by Lumelsky et al. (Lumeksky et al. 2006). This method divides the in vitro differentiation process into five stages. In Phase I, undifferentiated stem cells are expanded in culture. In stage II, the expanded ste...
Embodiment 3
[0118] Example 3: In vitro differentiation of stem cells---cardiomyocytes
[0119] 3.1 Materials and methods
[0120]3.1-1 Reagents: Purchase phosphate buffer solution (PBS) from Invitrogin; α-minimallessential medium (α-MEM); Dulbecco modified Eagle's medium (DMEM); fetal calf serum (FCS); knockout serum; penicillin / streptomycin; Sexomycin B; L-glutamin; 0.25% Trypsin-EDTA; β-mercaptoethanol; non-essential amino acids; , cTnl) antibody was purchased from Chemicon (USA); primers for RT-PCR: α-myosin light chain ventricular (α-MHC) (ggggacagtggtaaaagcaa (sense), tccctgcgttccactatctt (antisense); 512bp), Nkx2. 5 (ggtggagctggagaagacaga(sense), cgacgccgaagttcacgaagt(antisense); 536bp) (Passier et al. 2005). Atrial natriuretic factor (ANF) (gaaccagagggggagacagag (sense), ccctcagcttgctttttaggag (antisense), 406bp) and myosin light chain 2v (myosin light chain 2v, MLC2v) (firstround: gcgccaactccaacgtgttct (sense); gtgatgatgtgcca (cca ); nested PCR: aggaggccttcactatcatgg (sense); g...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com