Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel Bt protein Cry30Fa1, coding gene thereof and use

A technology of cry30fa1, bt protein, applied in application, genetic engineering, plant genetic improvement and other directions

Inactive Publication Date: 2009-08-12
SICHUAN AGRI UNIV +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, studies have proved that Bti has not yet found resistance problems in the use of field (Regis L, et al., 2000. The use of bacterial larvicides in mosquito and black fly control programs in Brazil. Mem. Instituto Oswaldo Cruz, 95: 207-210. ), but the problem of mosquito resistance to it has been continuously confirmed in the laboratory, and this situation may also appear in the field (Georghiou GP, and Wirth MC, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera: Culicidae). Applied and Environmental Microbiology, 63: 1095-1101.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel Bt protein Cry30Fa1, coding gene thereof and use
  • Novel Bt protein Cry30Fa1, coding gene thereof and use
  • Novel Bt protein Cry30Fa1, coding gene thereof and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Cloning of cry30Fa1 gene

[0026] The present invention is a new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) isolated from the soil in the virgin forest area of ​​Muchuan, Sichuan Province. No. 3, Datun Road, Chaoyang District, City, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCC No.2719.

[0027] In this example, the full-length sequence of the cry30Fal gene was cloned by the following method.

[0028] The total DNA of strain BtMC28 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:

[0029] P1: 5'ATGAAGCCGTATCAAAGTG3'

[0030] P2: 5'GTTCACTGGACAAGCAAATGC3'

[0031] PCR reaction system:

[0032] 10×buffer 2.5μl

[0033] MgCl 2 (25mM) 1.5μl

[0034] Taq enzyme 0.2μl

[0035] dNTPs (2.5mM) 2μ...

Embodiment 2

[0040] Example 2 Expression of cry30Fal gene and determination of insecticidal activity

[0041] According to the sequences at both ends of the open reading frame of the cry30Fa1 gene, a pair of specific primers cry30F: 5′-GCG were designed and synthesized CATATG (NdeI)ATGAAGCCGTATCAAAGTG-3'; cry30R: 5'-CG GAATTC (EcoR I)GTTCACTGGACAAGCAAATGC-3', respectively at the 5' end primer Nde I and EcoR I restriction sites. The total DNA of BtMC28 was used as a template to amplify. The reaction procedure and reaction system were the same as in Example 1. The amplified product was double digested with Nde I and EcoR I, and the digested product was the same as the vector pET-30a after double digestion. (+) ligation, transform E.coli DH5α competent cells, extract its plasmids, and electrophoresis to verify that the size of the inserted fragment meets the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides new Bt protein Cry 30 Fal and encoding gene sthereof. The protein has the amino acid sequences shown in the SEQ ID NO.2 or the protein has the amino acid sequences shown in the SEQ ID NO.2 which are substituted, lacked and / or added with one or a plurality of amino acids and have the same activity. The protein can be used for preparing Bt pesticide. The gene can be transformed into crops such as cotton, corn, rice, vegetables and the like which are caused to have corresponding anti-insect activity, thus reducing the usage volume of the pesticide, reducing environmental pollution and having important economic value and application prospect.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a novel Bt protein and its coding gene and application. Background technique [0002] In the process of human production, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic losses caused by insect pests in agricultural production worldwide are as high as 14%, disease losses reach 12%, and weed damage losses reach 11%. %. The loss was as high as 126 billion US dollars, equivalent to half of China's total agricultural output value, and more than four times that of the United Kingdom. In addition, mosquito-borne diseases occupy an important position in preventive medicine, among which mosquito-borne diseases such as dengue fever and yellow fever have strong transmissibility, wide prevalence, high incidence and great harm. According to WHO statistics, as many as 80 million people are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/325C12N15/32C12N15/63C12N5/10C12N15/82A01N63/02A01P7/04C12R1/07
CPCY02A40/146
Inventor 李平郑爱萍朱军谭芙蓉王玲霞王世全邓其明李双成刘怀年宋福平束长龙张杰
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com