Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Preparation for porcine defensin engineering yeast strain

A technology of porcine defensin and yeast engineering, applied in the fields of biotechnology and genetic engineering pharmacy, can solve the problems such as the preparation method and technology of recombinant porcine defensin which have not yet been seen, and achieve the effects of reducing production cost and improving antibacterial activity.

Inactive Publication Date: 2008-10-01
HEBEI AGRICULTURAL UNIV.
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the prior art, there are only some patented technologies for the production of animal antimicrobial peptides, such as the expression of rabbit defensin genes in plants, the expression of housefly defensin genes in bacteria and yeast, and the expression of rabbit defensin genes in chlorella Expression, etc., there is no report on the preparation method and technology of recombinant porcine defensin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation for porcine defensin engineering yeast strain
  • Preparation for porcine defensin engineering yeast strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0019] (1) Transformation of porcine β-defensin-2 gene

[0020] Collect 100ml of fresh anticoagulated pig blood, centrifuge and take buffy coat, use Trizol method to prepare total RNA from pig white blood cells, design upstream and downstream primers according to animal defensin conserved sequence, upstream primer: 5'-gcgg ggtacc accatgagggccctctgcttg, downstream primer: 5'-ctag tctaga tcagcggatgcagcacttg. The porcine defensin gene was amplified by RT-PCR, and the gene was cloned into the KpnI and XbaI sites of the eukaryotic expression vector pcDNA3.1 produced and sold by Invitrogen Company of the United States through restriction sites to construct eukaryotic expression carrier.

[0021] Using the site-directed mutagenesis method, refer to the sequence of other animal defensins, carry out site-directed mutations on the porcine defensin gene, obtain several mutants, express the mutant genes in cultured 293T cells, and purify the expression product—porcine defensin from th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a preparing method of a porcine defensins engineering yeast strain, firstly, the porcine defensins gene is modified by method of genetic site-directed mutagenesis, mutant of porcine defensins gene having high biological activity is screened, then the porcine defensins gene which codon is optimized is artificially synthesized by the conventional codon of yeast strain, the engineering yeast strain having high yield, strong biological activity for producing porcine defensins is obtained by multiple screens. The porcine defensins engineering yeast strain kills the yeast by heating after fermented, directly used as feed additive by concentrated, having no separating and extracting courses, reducing the production cost of the defensins, improving the economic effect of the production enterprise. The invention provides conditions for mass industrial production of defensins, resolving the displacement of the porcine feed antibiotics additive.

Description

technical field [0001] The invention relates to a preparation method of porcine defensin yeast engineering bacteria, which belongs to the technical field of biotechnology and genetic engineering pharmacy. Background technique [0002] Defensin is an important antibacterial peptide substance in animals. It not only has a killing effect on bacteria, fungi, and enveloped viruses, but also has a certain killing effect on mycoplasma, chlamydia, spirochetes and some malignant cells. Therefore, in the pharmaceutical industry It has broad development and application prospects. In the field of animal husbandry, animal β-defensins have good research and development value. With the widespread use of antibiotics in feed and people's higher and higher requirements for food and environmental quality, people's awareness of the side effects of antibiotics is deepening, and the application of antibiotics in feed industry is facing the situation of being eliminated or banned. At present, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/12C12N15/81C12R1/85
Inventor 仲飞
Owner HEBEI AGRICULTURAL UNIV.
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com