Test paper for rapidly detecting hog cholera antibody and method for making same
A swine fever antibody and test strip technology, applied in the field of animal disease inspection and quarantine, can solve the problems of long detection time, high detection cost, and complicated operation process, and achieve low production costs, stable and uniform antigenic components, good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 The present invention detects the preparation of swine fever antibody test strip
[0031] 1 Preparation of classical swine fever E2 protein
[0032] ①Material source
[0033] (1) The source of the virus. Attenuated classical swine fever (prepared by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences).
[0034] (2) Sources of carriers, recipient bacteria and reagents. Recipient strain BL21: Diagnosis and Epidemiology Center, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences; PET-30a, restriction endonucleases and various modified enzymes were purchased from Dalian Bao Biological Company; IPTG, kanamycin: Shanghai Sangong .
[0035] (3) Primer synthesis. Primers used to amplify the gene fragment encoding the B / C antigen region: upstream of P: (5'tcgaattcatgcgtctagcctgca 3'); downstream of P: (5'tggtgagtgagtaaagcccccttat 3'), the upstream and downstream primers contain enzymes designed as EcoRI and Pst...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com