Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying HBV gene mutation type, special chip and reagent kit

A gene chip and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, etc., can solve problems such as difficult to accurately distinguish, difficult to interpret results, difficult to distinguish mutant/wild type coexisting individuals, etc.

Active Publication Date: 2008-05-21
BOAO BIOLOGICAL CO LTD +1
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the reagents are expensive, and there are a small number of problems that are not easy to interpret the results due to DNA sequence polymorphisms, so they are rarely used in clinical testing; (7) Sequence Specific Oligonucleotide Probe (SSOP) gene chip Technology: Utilize the high-throughput and parallel detection characteristics of the gene chip to design probes for many genes that cause mutations. These probes are combined on the same chip. Needle hybridization, according to the hybridization signal to determine the mutant genotype of HBV
This technology is difficult to accurately distinguish single base differences, and the specificity is poor; at the same time, it is difficult to accurately distinguish mutant / wild-type co-existing individuals
[0008] The above-mentioned technologies all have a common deficiency, that is, any single method cannot detect HBV gene mutation types in dominant populations / disadvantaged populations in a high-throughput, accurate and specific manner

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying HBV gene mutation type, special chip and reagent kit
  • Method for identifying HBV gene mutation type, special chip and reagent kit
  • Method for identifying HBV gene mutation type, special chip and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Embodiment 1, detect the cloning plasmid sample of known HBV mutation with gene chip of the present invention and method

[0087] 1. Mutant Cloning Plasmid Preparation

[0088] 1) Preparation of wild type plasmid pGEM-T-HBVPWT of HBV P gene

[0089] Using HBV genomic DNA as a template, use the upstream primer (sequence: CAAGGTATGTTGCCCGTTTG) and downstream primer (sequence: GGAGTTCCGCAGTATGGATCGG) to PCR amplify the nucleotide sequence from the 1448th to the 2191st deoxyribonucleotide of GenbankAccession Number AB205123 at the 5' end , the PCR product was connected to the pGEM-T Easy vector to obtain a fragment containing the HBV P coding gene from the 1448th to the 2191st deoxyribonucleotide at the 5' end of Genbank AccessionNumber AB205123 containing the nucleotide sequence The recombinant plasmid pGEM-T-HBVPWT is a wild-type plasmid including HBV P gene.

[0090] 2) HBV P gene mutant plasmids pGEM-T-HBVPMU180M, pGEM-T-HBVPMU181T, pGEM-T-HBVPMU181V, pGEM-T-HBVPMU204...

Embodiment 2

[0167] Embodiment 2, use gene chip of the present invention and method to detect the clinical sample of known HBV mutation

[0168] 1. Nucleic acid preparation of clinical samples

[0169] The isolated case samples (HBV-positive serum) with known HBV gene mutations were provided by the Institute of Liver Diseases, People's Hospital. Sample 1# is the mixed type of wild type (WT) of HBV P gene, mutant type 180M of HBV P gene and mutant type 204I of HBV P gene; sample 2# is wild type (WT) of HBV P gene, HBV P gene The mixed type of the mutant 180M of the HBV P gene and the mutant 204S of the HBV P gene; the sample 3# is the mixed type of the wild type (WT) of the HBV P gene, the mutant 181V of the HBV P gene and the mutant 236T of the HBV P gene.

[0170] Use QIAamp  DNA Blood Mini Kit (Qiagen, Hilden, Germany) was used to extract genomic DNA from HBV positive sera.

[0171] 2. Preparation of multiplex PCR primers and probes for gene chips

[0172] (1) Primer

[0173] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying HBV gene mutation type and a chip and a reagent box which are especially used with the method. The method for identifying the HBV gene mutation type takes the detected the genome of the hepatitis B virus as the template and uses the following primer group and a DNA polymerase which has no exonuclease activity from the 3'end to 5' end for implementing multiple PCR magnification; the primer group comprises a universal primer and a or more than one special primers; the special primer 5' end is a bar code sequence and the length of the bar code sequence is 5 to 25 nt; the bar code sequence has a comparatively low homology with the hepatitis B virus; the special primer totally matches with the corresponding segment of the hepatitis B virus comprising wild base group or mutant base group at a mutation point; the gene chip comprises a plurality of probes and the probes are corresponding to the bar code sequence one to one and every probe only contains one bar code sequence.

Description

technical field [0001] The invention relates to a method for identifying HBV gene mutation types in the field of gene analysis, as well as a dedicated chip and a kit. Background technique [0002] Chronic hepatitis B is one of the most serious health problems at present. About 2 billion people in the world have been infected with hepatitis B virus (HBV), of which 350 million people are chronic HBV infected people, and about 1 million people die every year. Liver failure, liver cirrhosis and primary hepatocellular carcinoma (HCC) caused by HBV infection. my country is a high prevalence area of ​​HBV infection. There are 130 million hepatitis B virus carriers and more than 30 million hepatitis B patients in China. The positive rate of HBsAg in the general population was 9.09%. HBV is a highly mutated virus. During its reverse transcription and replication process, due to the lack of correction function of RNA polymerase and reverse transcriptase, the virus can undergo one or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/25
Inventor 郭永赵传赞程京高华方王国青
Owner BOAO BIOLOGICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products