Primer and Probe for Use In Detection of Mycobacterium Kansasii and Method for Detection of Mycobacterium Kansasii Using The Same

a technology of mycobacterium kansasii and probe, which is applied in the field of primer and probe for use in the detection of mycobacterium kansasii and the detection method of mycobacterium kansasii using the same, can solve the problems of slow growth of bacterium belonging to the genus i>mycobacterium /i>, difficult to differentiate tuberculosis from nontuberculous

Inactive Publication Date: 2013-03-14
WAKO PURE CHEMICAL INDUSTRIES
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The method described in this patent allows for faster and more accurate detection of a specific bacteria called M. kansasii compared to traditional methods of identifying bacteria through culture examination. Additionally, this method helps to exclude false positive results and ensures high accuracy in detecting M. kansasii. It can also be used to quantify M. kansasii cells.

Problems solved by technology

However, since nontuberculous mycobacterium disease has no specific clinical symptom, it is quite difficult to differentiate tuberculosis from nontuberculous mycobacterium disease by clinical observation and histopathological manifestation, moreover, to specify the species of the nontuberculous mycobacterium.
By this test, only “positive acid-fast bacterium” can be recognized, and differentiation of tuberculosis bacterium from nontuberculous mycobacterium cannot be achieved.
However, in general, growth of bacterium belonging to genus Mycobacterium is slow, and takes considerable time for its culture.
In addition, there is another problem that it requires additional 2 to 3 weeks to complete various biochemical tests for the identification of bacterial species.
However, since some other species belonging to genus Mycobacterium show the same properties as M. kansasii shows, the identification of M. kansasii by its coloring property is generally of a problem.
In addition, as the judgment is made positive regardless of the size of bacterial count, and since the number of the bacterium is unknown, diagnosis of infectivity whether it is positive or not will be provided with uncertainty.
In addition, since the method has a problem that due to too high sensitivity, the possibility of false positive judgment or the like tends to be made.
2). However, in this study, it has been reported that both pMK1-9 probe and commercially available DNA probe (ACCU-PROBE™) were unable to detect considerable number of strain types of M. kans
Moreover, for example, identification of DNA region effective for detecting M. kansasii has also been studied (for example, Patent Document 1 and the like), however, the present situation is that the method of diagnosis specific to M. kansasii has not been established.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and Probe for Use In Detection of Mycobacterium Kansasii and Method for Detection of Mycobacterium Kansasii Using The Same
  • Primer and Probe for Use In Detection of Mycobacterium Kansasii and Method for Detection of Mycobacterium Kansasii Using The Same
  • Primer and Probe for Use In Detection of Mycobacterium Kansasii and Method for Detection of Mycobacterium Kansasii Using The Same

Examples

Experimental program
Comparison scheme
Effect test

experimental example 1

Selection of Clone Derived from M. Kansasii Genome

(1) Preparation of DNA Sample

[0195]Firstly, colonies of M. kansasii (Mycobacterium kansasii) cultured on the Ogawa's medium are collected and suspended in purified water and autoclaved (at 120° C. under 2 atmospheres for 20 minutes), and by way of disruption treatment (physical disruption using 2 mm diameter of glass beads) followed by centrifugation, the supernatant solution was obtained. From the supernatant solution obtained, extraction and purification of DNA was carried out using an ion-exchange resin type DNA extraction and purification kit, Genomic-tip (manufactured by QIAGEN GmbH), and obtained genomic DNA derived from M. kansasii.

[0196]The purified DNA obtained was adjusted to give final concentration of 400 ng / μl (in 10 mM Tris-HCl buffer, pH 8.9), and used as a DNA sample.

[0197]Separately, using a specific sequence of KATS2 for M. kansasii as described in JP-A-11-155589 and a specific sequence of M. tuberculosis (Mycobact...

example 1

Evaluation of the Specificity of the Candidate Clone for M. Kansasii

[0247]The 8 candidate clones obtained in Experimental Example 1 were evaluated by performing agarose gel electrophoresis detection experiment in combination with the PCR amplification system for their availability for the M. kansasii specific detection system using nucleic acid amplification detection system.

(1) the Synthesis of the Primer for PCR

[0248]Firstly, based on the result of sequence analysis of the candidate clone 1, the primer sequence for the PCR amplification detection was designed using a web tool for primer design, Primer 3 (Whitehead Institute for Biomedical Research). Using the designed “CGGCCATTGTTCTACAGTCT” (SEQ ID NO: 5; hereinafter referred to as 1c_plate1_Fw1) and “TAGAGATCCATCGCTTTGGT” (SEQ ID NO: 6; hereinafter referred to as 1c_plate1_Rv1), the PCR was carried out as described below. The designed oligonucleotide was synthesized by the phosphoamidite method using the ABI 392 DNA synthesizer ...

example 2

Detection of M. Kansasii Using the Primer of the Present Invention 1

[0262]As to the candidate clone 2 obtained in (6) of Experimental Example 1, based on the nucleotide sequence thereof, 6c_plate1_Fw1 (SEQ ID NO: 13) as a forward primer and 6c_plate1_Rv1 (SEQ ID NO: 14) as a reverse primer were designed and synthesized by the same method as described in (1) of Example 1. Using the same samples and reagents, and by the same method as described in (2) to (4) of Example 1, the PCR and the electrophoresis were carried out.

[0263]In addition, the nucleotide sequence of the candidate clone 2 obtained from the result of sequence analysis was the one depicted in SEQ ID NO: 2, and the location of each designed primer on the nucleotide sequence of the candidate clone 2 was as shown in FIG. 2.

[0264]By the PCR using forward primer 6c_plate1_Fw1 and reverse primer 6c_plate1_Rv1, DNA fragment with 216 base pair (SEQ ID NO: 57) in the candidate sequence 2 which is locating in the M. kansasii genome...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses an oligonucleotide which comprises a part or the entire sequence of the nucleotide sequence depicted in SEQ ID NOS: 1-4, or a part or the entire sequence of a nucleotide sequence complementary to SEQ ID NOS: 1-4, wherein the oligonucleotide is capable of hybridizing with the nucleotide sequence of Mycobacterium kansasii; a primer and a probe for detecting M. kansasii comprising the oligonucleotide; and a method for detecting M. kansasii using the primer and / or probe.The methods enable the detection of M. kansasii more rapidly and with higher accuracy compared with conventional methods performed by culture. Further, the methods can exclude false positive results for the diagnosis and can also detect and diagnose M. kansasii with higher accuracy compared with methods performed by PCR using conventional primers and / or probes. Still further, the method can quantify M. kansasii cells.

Description

RELATED APPLICATIONS[0001]This is a division of application Ser. No. 11 / 920,234, filed Nov. 13, 2007, issued as U.S. Pat. No. 8,242,249, which is a national stage application of PCT Application No. PCT / JP2006 / 309514, filed May 11, 2006, which claims the benefit of JP 2005-141153, filed May 13, 2005, all of which are incorporated herein by reference.TECHNICAL FIELD[0002]The present invention relates to a method for detecting and / or identifying M. kansasii (Mycobacterium kansasii, hereinafter described as M. kansasii) through the use of amplification of nucleic acid and detection system thereof in clinical laboratory test.BACKGROUND ART[0003]Nontuberculous mycobacterium (NTM) is a gram positive bacillus having acid-fast characteristics classified into genus Mycobacterium, and is a sort of acid-fast bacterium other than tuberculosis complex and Mycobacterium leprae. [0004]Among nontuberculous mycobacterium, clinically problematic bacterial strain is known to include Mycobacterium kansa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68G01N21/64G01N21/76
CPCC12Q1/04G01N2333/35G01N33/56922C12Q1/689
Inventor ISHIKAWA, TOMOKAZU
Owner WAKO PURE CHEMICAL INDUSTRIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap