Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CDR grafted type III anti-CEA humanized mouse monoclonal antibodies

a humanized mouse and monoclonal antibody technology, applied in the field of immunological reagents, can solve the problems of limiting the diagnostic and therapeutic utility of some of the reagents so far developed, limiting the diagnostic or therapeutic agent from reaching the target site, and reducing the effective concentration of the targeting agen

Inactive Publication Date: 2005-04-28
IMMUNOMEDICS INC
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0028]“CEA” refers to carcinoembryonic antigen, a 180 kDa glycoprotein that is expressed in most adenocarcinomas of endod

Problems solved by technology

These efforts have produced great progress, but a variety of largely unanticipated problems have limited the diagnostic and therapeutic utility of some of the reagents thus far developed.
Among the most intractable problems is that which is caused by the human immune system itself, which may respond to the targeting conjugate as a foreign antigen.
Furthermore, even when adverse side effects are minimal (for example, as in a single administration), circulating HAMAs decrease the effective concentration of the targeting agent in the patient and therefore limiting the diagnostic or therapeutic agent from reaching the target site.
Several approaches have been developed to overcome or avoid this problem, with only limited success.
None of these approaches has proven altogether satisfactory.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CDR grafted type III anti-CEA humanized mouse monoclonal antibodies
  • CDR grafted type III anti-CEA humanized mouse monoclonal antibodies
  • CDR grafted type III anti-CEA humanized mouse monoclonal antibodies

Examples

Experimental program
Comparison scheme
Effect test

example 1

Culturing Antibody Producer Cells

[0082] A mouse / mouse hybridoma cell line producing Class III, anti-CEA monoclonal antibodies was established according to Hansen et al. (1993) above and Primus et al. (1983) above.

[0083] Cells were selected for secretion of kappa IgG1 by testing conditioned medium using standard isotyping techniques. A variety of kits for this purpose are commercially available. Such cells were screened for production of antibody by testing conditioned medium using a standard blocking assay described above. Stocks of producer cells that proved out in the assay were expanded and frozen in liquid nitrogen.

example 2

Isolating RNA from Producing Cell Lines

[0084] MN-14-producing cells were expanded in culture, collected by centrifugation and washed. Total RNA was isolated from the cells in the pellet according to Favaloro et al., Methods in Enzymology 65: 718 (1980) and Orlandi et al., Proc. Nat'l Acad. Sci., USA 86: 3833 (1989), which are incorporated by reference.

example 3

cDNA Synthesis and Amplification of the Heavy Chain Variable Region

[0085] mRNA from MN-14 producing cells was used to synthesize cDNA using standard techniques of cDNA synthesis and DNA amplification by PCR, as described below. In general, the primers used for PCR included a restriction endonuclease cleavage site at their 5′ ends to facilitate cloning of the amplification product. An oligonucleotide complementary to the end of the sense strand of the DNA encoding the first constant region domain of the murine IgG1 heavy chain (“CH1”) was used to prime first strand cDNA synthesis by reverse transcriptase. The sequence of this primer, CG1FOR, is shown in Table 1. Table 1 below provides other oligonucleotide sequences used herein.

TABLE 1OLIGONUCLEOTIDE SEQUENCESSEQ.IDNO.CG1FOR415′ GGAAGCTTAGACAGATGGGGGTGTCGTTTTG 3′VH1FOR425′ TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG 3′VH1BACK435′ AGGTSMARCTGCAGSAGTCWGG 3′SH1BACK445′ TGGAATTCATGGRATGGAGCTGGRTCWTBHTCTT 3′SH2BACK455′ TGGAATTCATGRACTTCDGGYTCAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Therapeuticaaaaaaaaaa
Nucleic acid sequenceaaaaaaaaaa
Login to View More

Abstract

A Class III, anti-CEA monoclonal antibody, preferably a monoclonal antibody comprising the complementarity-determining regions (CDRs) of a parental murine Class III, anti-CEA monoclonal antibody is disclosed. This monoclonal antibody is preferably a humanized monoclonal antibody in which the CDRs are engrafted to the framework regions of a heterologous antibody, wherein the humanized monoclonal antibody retains the binding specificity of the parental murine monoclonal antibody. A preferred Class III, anti-CEA monoclonal antibody is one in which the preferred heterologous antibody is from a human. Also provided are DNA constructs, vectors, cells and methods for producing the Class III, anti-CEA monoclonal antibodies, and diagnostic and therapeutic conjugates using same. Methods of treatment with a Class III, anti-CEA monoclonal antibody and with the conjugate containing this monoclonal antibody are provided as well as methods of diagnosis with the conjugate containing this monoclonal antibody.

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS [0001] This application is a continuation of application Ser. No. 09 / 253,794, filed Feb. 22, 1999, now pending, which is a divisional of application Ser. No. 08 / 318,157, filed Oct. 5, 1994, now U.S. Pat. No. 5,874,540, which are both incorporated by reference in their entirety. This application claims only subject matter disclosed in the parent applications and therefore presents no new matter.BACKGROUND OF THE INVENTION [0002] The invention relates to immunological reagents for diagnostic and therapeutic use in colon and other cancers. In particular, the invention relates to humanized anti-carcinoembryonic antigen (“CEA”) monoclonal antibodies (“mAbs”) that have the binding affinity characteristics of corresponding mouse anti-CEA mAb (MN14) and the antigenic and effector properties of a human antibody. Further, the invention relates to humanized mAbs in which the complementarity determining regions (“CDRs”) of an anti-CEA murine mAb is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/12C12N15/09A61K38/00A61K39/395A61K47/48A61K51/00A61P35/00C07K16/30C07K16/46C12N5/10C12N15/13C12P21/08C12R1/91
CPCA61K38/00A61K47/48576C07K16/3007C07K2319/00C07K2317/56C07K2317/565C07K2317/24A61K47/6853A61P35/00
Inventor HANSEN, HANSARMOUR, KATHRYN
Owner IMMUNOMEDICS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com