Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Cecropin A-magainin hybrid gene engineering bactericidal peptide

A genetic engineering and cecropin-like technology, which is applied in the direction of hybrid peptides, antibacterial drugs, peptides, etc., can solve the problems of high price, cumbersome procedures, and high cost of solid-phase synthetic peptides, and achieve low production costs, good application prospects, The effect of price ease of operation

Inactive Publication Date: 2007-01-17
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Antimicrobial peptides extracted from natural resources have high cost, low yield, and cumbersome procedures; solid-phase synthetic peptides are quite expensive, not suitable for my country's national conditions, and are difficult to apply in actual clinical practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cecropin A-magainin hybrid gene engineering bactericidal peptide
  • Cecropin A-magainin hybrid gene engineering bactericidal peptide
  • Cecropin A-magainin hybrid gene engineering bactericidal peptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0054] The preparation method of cecropin A-maggainin hybrid genetic engineering antimicrobial peptide comprises:

[0055] 1) Synthesis of cecropin A-Magnin (CecA-Mag) hybrid peptide parent gene

[0056] Select 1-7 amino acids of the mature peptide of cecropin A (CecA) with the accession number X06672 on Genbank and 2-12 amino acids of the mature peptide of Magaining (Mag) with the accession number J03193 on Genbank, and design two primer fragments For F1 and F2, use the F1 sequence and F2 sequence fragments as templates and primers for SOE PCR amplification to obtain a synthetic CecA-Mag hybrid peptide gene;

[0057] Primer F1, SEQ.ID.NO.1;

[0058] 5'CCTCTCGAGAAAAAGAAAGTGGAAGCTGTTCAAGAAGATCGGTCCAGGTAAG3'

[0059] Primer F2, SEQ.ID.NO.2;

[0060] 5'TAGTCTAGACTAGAACTTCTTGGCACTGTGCAGGAACTTACCTGGACCGATCTTCTT3'

[0061] PCR reaction system 50μl: 10×PCR Buffer, 5μL, MgCl 2 , 3 μL; dNTP, 1 μL; primer F1 and primer F2, 2 μL each; TaKaRaExTaqTM 0.5 μL; sterile ultrapure water, 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An eka-cecropinA-magainin heterozygous gene engineering antibacterial peptide is prepared by adopting No.1-7 amino acid residue on N end of cecropinA CA and No.2-12 amino acid residue on N end of magainin M, design synthesizing heterozygous peptide CA(1-7)-M(2-12) gene by codon, connecting with carrier pPICZ alpha-A, mutating by point mutation technology to obtain mutant pPICZ alpha-CA-Mu-1, pPICZ alpha-CA-Mu-2 and pPICZ alpha-CA-Mu-3, converting SMD1168, and expressing CecA-Mag heterozygous antibacterial peptide to make into use under alcohol hydrogenase starter regulation.

Description

A technical field [0001] The invention discloses a cecropin A-maggainin hybrid genetically engineered antibacterial peptide, which belongs to the technical field of vaccine drug production by genetic engineering in the biotechnology pharmaceutical industry. Two background technology [0002] Since the discovery of penicillin in 1929, antibiotics have played an important role in the prevention of bacterial infections and livestock and poultry diseases. In particular, the discovery of β-lactam antibiotics has revolutionized the treatment of pathogenic bacterial infectious diseases, and antibiotics have become clinical treatments. Many achievements of modern animal husbandry and veterinary medicine are based on the application of antibiotics. However, the long-term, extensive and indiscriminate use of antibiotics has not only led to serious problems of drug resistance of pathogens, but also caused hidden public health diseases such as drug residues. The emergence of many drug-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K38/16A61P31/04C12N15/09C12N15/62C12N15/81
Inventor 陈溥言王秀青曹瑞兵周斌
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com