Cecropin A-magainin hybrid gene engineering bactericidal peptide
A genetic engineering and cecropin-like technology, which is applied in the direction of hybrid peptides, antibacterial drugs, peptides, etc., can solve the problems of high price, cumbersome procedures, and high cost of solid-phase synthetic peptides, and achieve low production costs, good application prospects, The effect of price ease of operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0054] The preparation method of cecropin A-maggainin hybrid genetic engineering antimicrobial peptide comprises:
[0055] 1) Synthesis of cecropin A-Magnin (CecA-Mag) hybrid peptide parent gene
[0056] Select 1-7 amino acids of the mature peptide of cecropin A (CecA) with the accession number X06672 on Genbank and 2-12 amino acids of the mature peptide of Magaining (Mag) with the accession number J03193 on Genbank, and design two primer fragments For F1 and F2, use the F1 sequence and F2 sequence fragments as templates and primers for SOE PCR amplification to obtain a synthetic CecA-Mag hybrid peptide gene;
[0057] Primer F1, SEQ.ID.NO.1;
[0058] 5'CCTCTCGAGAAAAAGAAAGTGGAAGCTGTTCAAGAAGATCGGTCCAGGTAAG3'
[0059] Primer F2, SEQ.ID.NO.2;
[0060] 5'TAGTCTAGACTAGAACTTCTTGGCACTGTGCAGGAACTTACCTGGACCGATCTTCTT3'
[0061] PCR reaction system 50μl: 10×PCR Buffer, 5μL, MgCl 2 , 3 μL; dNTP, 1 μL; primer F1 and primer F2, 2 μL each; TaKaRaExTaqTM 0.5 μL; sterile ultrapure water, 3...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com