Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for expressing anthrax bacteria gamma phage lyase and its special gene

A technology of phage lysing enzyme and Bacillus anthracis, which is applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of inability to efficiently express Escherichia coli, and achieve high specificity, strong lysis ability, and high expression level Effect

Inactive Publication Date: 2006-08-23
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since PlyG is encoded by phage, it cannot be expressed efficiently in E. coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing anthrax bacteria gamma phage lyase and its special gene
  • Method for expressing anthrax bacteria gamma phage lyase and its special gene
  • Method for expressing anthrax bacteria gamma phage lyase and its special gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1, the acquisition of optimized Bacillus anthracis gamma phage lyase coding gene BPlyG

[0029] 1. Primer design

[0030] The target gene sequence was obtained by overlapping extension PCR. Primers were designed as follows:

[0031] P1:( Nde I )5’>GGTATAC CATATG GAAATCCAGAAAAAAC<3’

[0032] P2: 5'>GTACTAAGTGCCCGTACACCATGAAACCGAAATACATTACTGTACACAACACTTACAATG<3'

[0033] P3: 5'>GTATCTTACATGATCTCTAACAATAACGAAGTGTCTTTCCACATCGCTGTAGACGATAAG<3'

[0034] P4: 5'>CTGGAACGTAACGCTTGGGCTTGTGGTGATGGCAACGGCTCTGGTAACCGTCAGTCTATC<3'

[0035] P5: 5'>CTAAATCCGGTGGCGACCGTTACTATAAAGCTGAAGACAACGCCGTGGATGTCGTTCGTC<3'

[0036] P6: 5'>CATCCCGATTGAGAACGTGCGTACCCACCAATCTTGGTCCGGTAAATACTGCCCGCACCG<3'

[0037] P7: 5'>GGGGTGCATTTATCCAAAAAGTTAAGAACGGCAATGTTGCTACCACTTCTCCGACCAAAC<3'

[0038] P8: 5'>CTTTCTCCCCGTACGAAACACCGGACGTGATGGGTGCCCTGACTTCTCTGAAGATGACTG<3'

[0039] P9: 5'>GACGGCCTGACCTACTTCATTTCTAAACCAACTTCCGACGCTCAATTGAAAGCCATGAAG<3'

[0040] P10: 5'>ATGGTGTACGGGCACTTAGTACC...

Embodiment 2

[0053] Embodiment 2, the efficient expression of recombinant PlyG in Escherichia coli

[0054] Escherichia coli BL21(DE3) was transformed with the recombinant plasmid pET-22b(+)-BPlyG, and the engineered bacteria-BpET-22b(+)-BPlyG, which could express Bacillus anthracis γ-phage lyase, was screened and inoculated with BpET-22b(+)- A single colony of BPlyG was cultured in 10 ml LB medium (containing 100 μg / ml carbenicillin) at 37° C. for 12 hours. Inoculate fresh LB medium (containing carbenicillin 100 μg / ml) at a volume ratio of 1:100, incubate at 37°C and 250 rpm for 10 hours, then inoculate into a 30L fermenter at a volume ratio of 1:50 and cultivate until bacterial liquid A 600 =1.4-1.6, divided into three parts, added IPTG to the final concentration of 0.2umol / L, 0.4umol / L, 0.8umol / L, continued to cultivate at 23°C for 4 hours, centrifuged to collect the bacteria, and uninduced pET- BL21(DE3) with 22b(+)-BPlyG and BL21(DE3) without pET-22b(+)-BPlyG were used as controls, r...

Embodiment 3

[0056] Example 3: Recombinant PlyG efficiently and specifically lyses Bacillus anthracis

[0057] Bacillus anthracis vaccine bacteria A16R (purchased from the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences of the Chinese People's Liberation Army) was cultivated to A600=0.4, washed with PBS and resuspended into a bacterial solution with A600=1.4, 1ml was taken, and 0ug, 2.5ug, 5.0ug and 10.0ug were purified by ion-exchange chromatography and mixed with highly expressed recombinant PlyG, and the A600 value of the A16R bacterial solution was dynamically measured with an ultraviolet spectrophotometer, and the decrease of the A600 value reflected that the bacteria were lysed. The result is as Figure 4 As shown, the results show that the lysis effect of PlyG on A16R is positively correlated with the amount of PlyG, and 10ug of PlyG can efficiently lyse Bacillus anthracis.

[0058] Use Bacillus thuringiensis and Bacillus cereus which are very simil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one method of expressing anthrax bacteria gamma phage lyase and its special gene. The gene has one of the following nucleotide sequence: 1) SEQ ID No. 2 in the sequence list; 2. polynucleotide sequence coding the protein sequence of SEQ ID No. 3 in the sequence list; and 3. the nucleotide sequence capable of hybridizing with the DNA sequence limited by SEQ ID No. 2 in the sequence list under high strict condition. The optimized anthrax bacteria gamma phage lyase gene of the present invention is expressed in colibacillus system in the high expression level with expressed anthrax bacteria gamma phage lyase as high as 75 % of the all bacillus protein, has powerful anthrax bacteria schizolyzing capacity and very high specificity, and may be used in the diagnosis and prevention of anthrax and the theoretical research of anthrax treatment.

Description

technical field [0001] The invention relates to a method for expressing bacillus anthracis gamma phage lyase and its special gene. Background technique [0002] Bacillus anthracis is a biological warfare agent that has attracted much attention. Bacillus anthracis can produce highly resistant spores that can survive for more than 40 years in dry soil. After 9 / 11, the terrorist incident of anthrax spores in the United States has attracted worldwide attention. Rapid and effective emergency measures after anthrax infection are particularly important. [0003] However, there are difficulties in the rapid diagnosis, prevention and treatment of anthrax in the current anthrax terror. Because Bacillus anthracis is very similar to some strains of Bacillus cereus and Bacillus thuringiensis, it brings difficulties to accurate, rapid and specific diagnosis; the existing anthrax vaccine has low immune effect and short protection time; but if terrorist attacks With war-agent-grade anthra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/36C12N15/63C12N15/70C12N1/21
Inventor 杨尧易艳平曹诚马清钧
Owner INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com