Supercharge Your Innovation With Domain-Expert AI Agents!

G-type lysozyme gene of Argopecten irradians and encoded protein and cloning method thereof

A kind of cloning method, the technique of gene coding, applied in the field of G-type lysozyme

Inactive Publication Date: 2006-04-26
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report of g-lysozyme in invertebrates. Related marine organisms have reported carp g-lysozyme reported by Savan, white shrimp c-lysozyme reported by Rogerio, zebrafish c-lysozyme reported by Feng Liu, and Hikima reported Flounder g-lysozyme, and shellfish i-lysozyme with homology to cly reported by Olsen, Nilson et al.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1. A cloned bay scallop G-type lysozyme gene has the following sequence:

[0017] (1) Information of SEQ ID NO.1 in the sequence listing

[0018] sequence features

[0019] Length: 659 bp

[0020] Type: nucleic acid

[0021] Chain type: double chain

[0022] Topology: Linear

[0023] Source: Bay Scallops (Argopecten irradians)

[0024] Sequence description:

[0025] GACGAGGCTGATTTGACAATGAATGCCCTAGTGGTTATAACGCTTCTT

[0026] GCTTTCAGCACTGGCGCCTGGGCAGCGTCCTACACGTGCCATGGTGA

[0027] CGTCAGGCGTCTTCATCCAACCGGAGAGCACAACGGAGGTAACGCTG

[0028] CCTCTCATAACGATGTTAAATATGACTACAACGACCTCCTTAACAAGA

[0029] AGTCTTGTTACGACCAGGCTGGAGCCACTTACTGTATCCAACCATCGG

[0030] TGATCGCTGCCTTAGCCAGCCGTGAGTCACGTGGTGGTCGCCTGTTGC

[0031] ATTCAACCAATGGATGGGGAGACCATCACCATGCTTACGGAATTTTAC

[0032] AGTGTGACATCCGTTACCACAGCTGTACCCAGCACGCATGGGACAGC

[0033] TGTGCACACATTTCCCAGATGGTTCAAAGAAGTCCTAGTGCCCTACATC

[0034] AATCAGGTGGCCCACAAAACATCCCACATGGTCAAAGGAGCAACAACT

[0035] CCTAGGTGGAA...

Embodiment 2

[0052] Embodiment 2. Cloning method of bay scallop G-type lysozyme gene

[0053]1) Extraction of total RNA from bay scallops and purification of mRNA: Collect hemolymph from the adductor muscle of bay scallops infected with Vibrio anguillarum with a syringe, centrifuge at 700g at 4°C for 10 minutes, use Trizol reagent from Invitrogen Company and refer to its instructions Total RNA was extracted from the hemolymph of bay scallops infected with Vibrio anguillarum, and the mRNA was purified using the Oligotex mRNA purification kit from QIAGENE;

[0054] 2) Gulf scallop cDNA library construction: use Stratatagene company cDNA Synthesis Kit and ZAP-cDNA Synthesis Kit (Stratagene) and refer to the instructions for use to carry out cDNA synthesis. After cleavage with Xho I endonuclease, QIAEX II Agarose Gel Extraction Kit from QIAGEN Company was used to recover the digested fragments larger than 100 bp, connected to the Uni-ZAP XR vector carrier of Invetrogen Company, and ZAP-cDNA® G...

Embodiment 3

[0062] Example 3. The application of the sequence of the bay scallop G-type lysozyme gene in the genetic selection of bay scallop

[0063] According to the sequence of SEQ ID NO.1 in the sequence table in Example 1, PCR and RT-PCR primers were designed to amplify and sequence the partial sequences of the G-type lysozyme genes of different individuals of the bay scallop, and compare different individuals in the G-type lysozyme gene. The difference in the enzyme gene sequence; at the same time, the difference in the expression level of the G-type lysozyme gene mRNA in different individuals was compared to guide the genetic selection of bay scallops.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to type G lysozyme, and is especially type G lysozyme gene of and its coded protein and cloning method. The type G lysozyme gene of gulf scallop has the base sequence shown in SEQ ID No. 1, and its coded protein has the amino acid sequence shown in SEQ ID No 2. The type G lysozyme gene of gulf scallop the present invention clones has polyadenyl acid tailing signal and polyadenyl acid tail, has important function in immunologic defence of gulf scallop, and may be used in the recombinant expression and gene transfer of lysozyme. The present invention lays foundation for the disease prevention and treatment, gene aided selective breeding and medicine development of gulf scallop.

Description

technical field [0001] The present invention relates to G-type lysozyme, especially bay scallop G-type lysozyme gene (cDNA complete sequence and amino acid sequence) and a cloning method for cloning bay scallop lysozyme from bay scallop cDNA. Background technique [0002] Lysozyme was discovered by Fleming in 1922 (Proc.R.Soc.Lond.B.Biol.Sci.1922). The full name of the enzyme is 1,4-β-N-lysozyme, also known as mucopeptide N-acetylmuramoyl hydrolase, which can hydrolyze the β between N-acetylglucosamine and N-acetylmuramic acid in the bacterial cell wall -1,4-glucosidic bond destroys the peptidoglycan scaffold, and the cells swell and crack under the action of internal osmotic pressure, causing bacterial lysis, so it is also called muramidase, that is, N-acetylmuramoside glycan hydrolase . Some Gram-negative bacteria, such as Escherichia coli and Salmonella typhi, are also destroyed by lysozyme. Human and animal cells have no cell wall structure and no peptidoglycan, so ly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/36C12N15/10
Inventor 宋林生邹慧斌胥炜相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More