Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rockfish insulin like growth factor I receptor gene and its application

A growth factor receptor, insulin-like technology, applied in genes. fields, achieve significant economic benefits, promote rapid growth, and achieve significant economic value

Inactive Publication Date: 2005-03-23
SUN YAT SEN UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The seed cultivation of grouper is the key to the sustainable development of aquaculture production, but there is no bait additive that can effectively promote the growth of grouper seed in artificial culture of grouper

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rockfish insulin like growth factor I receptor gene and its application
  • Rockfish insulin like growth factor I receptor gene and its application
  • Rockfish insulin like growth factor I receptor gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040]Example 1: Synthesis of the middle fragment of the grouper insulin-like growth factor I receptor gene According to the IGF-IR gene sequences of twelve species that have been registered in GeneBank, they are compared with Dnassist software for similarity, in the conserved region Design and synthesize a set of degenerate primers for nested PCR amplification. Sense primer Primer1703:

[0041] 5'T(G / T)AA(A / G)CC(C / T)TGGAC(A / C / T)CA(A / G)TA(C / T)GC3'(22bp);

[0042] Antisense primer Primer2935:

[0043] 5'CACTGAA(A / G)TA(C / T)TC(A / C / G / T)GG(A / G)TT(A / C / G)AC3'(22bp);

[0044] Antisense primer Primer3100:

[0045] 5'TC(A / G)TT(A / C / G / T)AC(A / C / T)GTCTT(A / G / T)ATGGC3'(20bp). The reaction conditions are: 95°C pre-denaturation for 5 minutes; the following is 38 cycles, divided into two stages: (1) 95°C denaturation for 30 seconds, 1°C drop from 50°C to 37°C every two cycles, annealing for 30 seconds, A total of 28 cycles, 72°C extension for 1 minute; (2) 95°C denaturation for 30 seconds, ...

Embodiment 2

[0047] Example 2: The synthesis operation of the 5' end fragment of the grouper insulin-like growth factor I receptor gene was carried out according to the GeneRacer Kit Protocol. According to the requirements of the kit, two specific downstream primers were designed based on the sequenced intermediate fragment of IGF-IR cDNA: antisense primer Primer 5R336: 5'CCTCTTCCTGGTCTCCCACACCTATG3' (26bp), nested antisense primer Primer 5R104n:

[0048] 5'GGTGCGGATGTAGACCACTTTGC3' (23bp).

[0049] Nested PCR was performed according to the general primers of the GeneRacer Kit kit and these two specific downstream primers, and finally a band with a molecular weight of about 2.4 kb was obtained. The first PCR reaction conditions are: 95°C pre-denaturation for 5 minutes; the following is 40 cycles, divided into two stages: (1) 95°C denaturation for 30 seconds, each cycle from 62°C to 47°C drops 0.5°C, annealing 30 seconds, a total of 32 cycles, 72°C extension for 1 minute; (2) 95°C denatura...

Embodiment 3

[0051] Example 3: Synthesis of Grouper Insulin-like Growth Factor I Receptor Gene Tyrosine Kinase Region Fragment

[0052] According to the obtained intermediate fragment and the sequence of the highly conserved region of the IGF-IRβ subunit-tyrosine kinase active region reported in other species, two specific sense primers and one degenerate antisense primer were designed to obtain grouper Fish IGF-IR tyrosine kinase active region fragment. Sense primer Primer 3R707: 5'GCCGTTCACAGTTTACCGCATCG3'(23bp), sense primer Primer 3R1109n:

[0053] 5'CGTCCTCTACGCTATGATCTTCG3'(23bp), antisense primer Primer3RYR1: 5'GGCTTGTTSTCMKCRCTGTAG3'(21bp), the first PCR reaction conditions are: 95°C pre-denaturation, 5min, followed by 30 cycles, 94°C denaturation, 30sec; 50°C -65°C annealing, 30sec; 72°C extension, 1min30sec, and finally 72°C extension, 10min. For the second PCR, the annealed amplification product of the first PCR at 52°C was diluted 50 times as a template, and the reaction cond...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rockfish insulin-like growth factor I receptor gene, which is a gene fragment with rockfish insulin-like growth factor I receptor gene cDNA sequence, obtained by using rockfish hypothalamic total RNA as a template and by RT-PCR and Gene RACER methods. The invention can obtain stable-source and low-cost recombinant protein of rockfish insulin-like growth factor I receptor, having an important application to preparing fry growth promoter or additive.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a gene. Background technique [0002] Insulin-like growth factors (IGFs) are a class of multifunctional cell proliferation factors with a wide range of biological effects and play an important role in embryonic and individual development. IGFs exert biological effects through two types of IGF receptors on the cell surface. There are two types of IGFs receptors, called IGF-I receptors (IGF-IR or type I IGF receptors) and IGF-II receptors (IGF-IIR or type II IGF receptors). Most of the effects of IGFs on cells are realized by combining with IGF-IR. IGF-IR is a tetrameric glycoprotein consisting of two extracellular α subunits and two transmembrane β subunits. The structure of IGF-IR is very similar to insulin receptor. The cysteine-rich region of the α subunit is the specific recognition site for its ligand, and the β chain of the cytoplasmic part contai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/65C12N15/12C12N15/16
Inventor 李文笙邝月媚林浩然
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com