High efficiency experssino human glicentin-1 gene engineering bacteria and its construction method and use
A technology of glucagon and genetically engineered bacteria, which is applied in the field of bioengineering and can solve the problems of high synthesis cost, difficult purification, and high price
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Construction of a genetically engineered bacterium that highly expresses human glucagon-like peptide-1: a genetically engineered bacterium containing 1 to 16 single strings of SD-TrxA-His·Tag-EK-GLP-1-TAA. The TrxA is thioredoxin.
[0053] The first step base sequence synthesis
[0054] Entrust a professional biotechnology company to follow the sequence: SD sequence-purification tag His Tag-enterokinase EK site-human glucagon-like peptide-1, that is, GLP-1 gene-stop codon TAA, the length of chemical synthesis is 215bp The base sequence of is as follows,
[0055] XbaI SD sequence
[0056] 5'-CC tctaga AATAATTTTGTTTAACTTTAAG AAGGAGA TATACATATGTCTGGA
[0057] Met Ser Gly
[0058] His·Tag BglII
[0059] TCAGGT CATCATCATCATCATCAT TCTTCT agatct GATGACGACGACAAG
[0060] Ser Gly His His His His His His His Ser Ser Gly Thr Asp Asp Asp Asp Lys
[0061] ...
Embodiment 2
[0073] Example 2 Construction of a genetically engineered bacterium that highly expresses human glucagon-like peptide-1: contains 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-His·Tag-EK-GLP-1-TAA.
[0074] The first step base sequence synthesis
[0075] With the first step of embodiment 1;
[0076] The second step is to construct a genetically engineered bacterium containing the DNA sequence of a single string of GLP-1 genes
[0077] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The enzymes are XbaI and EcoRI, the small fragments are purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction enzymes, the large fragments are purified and recovered, and the small fragments and large fragments recovered above are connected ...
Embodiment 3
[0080] Example 3 Construction of a genetically engineered bacterium that efficiently expresses human glucagon-like peptide-1: containing 1 to 16 single strings of P T7 - Genetically engineered bacteria of SD-TrxA-His·Tag-EK-GLP-1-TAA.
[0081] The first step base sequence synthesis
[0082] With the first step of embodiment 1;
[0083] The second step is to construct a genetically engineered bacterium containing the DNA sequence of a single string of GLP-1 genes
[0084] The DNA sequence of the single string of GLP-1 gene is P T7 -SD-His·Tag-TrxA-EK-GLP-1-TAA, the recombinant plasmid pMD18-T-GLP-1 obtained in the first step by double digestion with two restriction endonucleases, the two restriction endonucleases The endonuclease is KpnI / EcoRI, the small fragment is purified and recovered, the plasmid pET-32a(+) is double-digested with the same two restriction endonucleases, the large fragment is purified and recovered, and the small and large fragments recovered above are c...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com