Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for extablishing polymorphism adenoid tumour mouse model

A gonad and model technology, applied in the field of transgenic technology, can solve the problems of no overall animal level research report, lack of molecular mechanism research, no pleomorphic adenoma animal model, etc.

Inactive Publication Date: 2005-02-16
SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV +3
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although studies have suggested that PLAG1 is a potential oncogene, there is still no direct evidence for the relationship between the biological function of PLAG1 and its high expression and the pathogenesis of pleomorphic adenoma, and there is no research report on the whole animal level
In addition, due to the relatively lagging research on the molecular mechanism of pleomorphic adenoma, there is no suitable animal model of pleomorphic adenoma, which brings a lot of problems to the research, treatment, drug screening and prevention of postoperative recurrence of pleomorphic adenoma. inconvenient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for extablishing polymorphism adenoid tumour mouse model
  • Method for extablishing polymorphism adenoid tumour mouse model
  • Method for extablishing polymorphism adenoid tumour mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Construction of MMTV-PLAG1 plasmid

[0043] Use the following primers, primer PLAG381: 5'-TTACGACCACATGAAACTTGAG-3' (SEQ ID NO: 2), primer PLAG2003: 5'-TGAATCCATGTCCCAGAATCCT-3' (SEQ ID NO: 3), to total RNA in human salivary adenoma or placenta The cDNA obtained by reverse transcription was used as a template, and the human PLAG1 gene was obtained by conventional RT-PCR method. Then cloned directly into pGEM-Teasy vector (Promega) to obtain plasmid pGEMT-PLAG1.

[0044]MMTV-EGFR-stop (Xie W, Paterson AJ, Chin E, et al. Targeted expression of a dominant negative epidermal growth factor receptor in the mammary gland of transgenic mice inhibits pubertal mammary duct development. Mol Endocrinol. 1997; 11(12): 1766 81) Contains the MMTV LTR promoter. Cut MMTV-EGFR-stop with EcoRI, excise the EGFR gene, recover the vector fragment and dephosphorylate it with CIAP (bovine pancreatic alkaline phosphatase); cut pGEMT-PLAG1 with EcoRI, and recover the PLAG1 gene fragment; use ligase ...

Embodiment 2

[0046] PLAG1 was introduced into mouse fertilized eggs by microinjection and the production of transgenic positive mice

[0047] After the transgenic plasmid MMTV-PLAG1 was linearized with XhoI, the fragment (4.3kb) containing the MMTV LTR and PLAG1 genes was recovered. Linearized DNA (about 500 copies) was injected into the male pronucleus of a mouse fertilized egg, and the injected fertilized egg was transplanted to a pseudopregnant mouse. About 20 days later, the mice were born.

[0048] Three weeks after the mice were born, their tails were cut to extract DNA to analyze whether there was transgene integration: After two sets of PCR reactions were used for detection, the primers are shown in Table 1. The β-globulin gene contained in the MTV-PLAG1 plasmid was used as a probe to confirm by Southern blotting.

[0049] serial number

Sequence (5’-3’)

SEQ ID NO:

1

GenBank Number: U65002

1

2

TTACGACCACATGAAACTTGAG

2

...

Embodiment 3

[0053] The expression of transgene in mouse salivary gland

[0054] In order to detect whether the MMTV LTR / PLAG1 fusion gene is expressed in mice, Trizol reagent was used to extract total RNA from mouse salivary glands according to conventional methods. Take 20mg RNA for electrophoresis and transfer to nitrocellulose membrane, use PLAG1 gene fragment as probe for Northern blot hybridization.

[0055] It was found that PLAG1 transgene was expressed at a high level in 5 of the transgenic mouse lines ( figure 2 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kind of polymorthy adenoma animal model. Roll FLAG1 expression box from out source in the animal's gene group. The box contains promoter, FLAG1 code list relating to the operation of promoter. The rotuled gene mice get spontaneous salivary gland tumor, which accord with main pathology character of men's multiformity tumor. The invention also provides the preparation of the model and the model's use.

Description

Technical field [0001] The invention relates to the field of transgenic technology. More specifically, it relates to a pleomorphic adenoma mouse model, a method for establishing the pleomorphic adenoma mouse model, and the use of the pleomorphic adenoma mouse model. Background technique [0002] Pleomorphic adenoma (pleomorphic adenoma) is the most common salivary gland tumor in oral and maxillofacial surgery. It usually occurs in the parotid and palatine glands, and is between benign and malignant tumors. It is a typical border-line tumor and accounts for approximately all salivary glands. 53.9% of tumors. Pleomorphic adenoma, also known as mixed tumor, has diversity in histopathological morphology and can contain tumor epithelioid tissue, cartilage-like tissue and mucous-like tissue. [0003] A large number of cytogenetic studies have found that abnormal karyotypes often appear in pleomorphic adenomas. According to statistics, pleomorphic adenomas with a normal karyotype accoun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01K67/027A61K49/00C07H21/00C12N15/12C12Q1/02C12Q1/68
Inventor 王铸钢张成平赵旭东杨雯郡
Owner SHANGHAI BIOMODEL ORGANISM SCI & TECH DEV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com