Fusion anticaries DNA vaccine and prepring method thereof

A DNA vaccine and anti-caries technology, which is applied in the field of preparation of PAc and GTFs fusion anti-caries DNA vaccine, can solve the problems of short duration, high cost, difficult preparation and purification of polypeptides, etc.

Inactive Publication Date: 2003-05-28
WUHAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are many deficiencies in the above various anti-caries peptide vaccines. Firstly, the preparation and purification of these peptides is difficult, generally takes several weeks and is expensive, and special conditions are required for storage; secondly, peptide anti-caries vaccines stimulate the body to produce effective immunity. The ability to respond is poor, and it is often necessary to add various immune adjuvants that are harmful to the human body; peptide anti-caries vaccines, like other peptide vaccines, generally have a short duration of induction of specific immune responses, and repeated vaccinations are required to achieve satisfactory results In addition, peptide vaccines generally cannot induce immune responses in infants and young children.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion anticaries DNA vaccine and prepring method thereof
  • Fusion anticaries DNA vaccine and prepring method thereof
  • Fusion anticaries DNA vaccine and prepring method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] Below in conjunction with accompanying drawing, the present invention is described in further detail:

[0017] according to Figure 1-6 It can be seen that using professional molecular biology software: DNASIS comprehensive DNA sequence analysis software, Gene Construction kit 2.0 gene simulation cloning software, Omiga comprehensive molecular biology analysis software, BLAST homologous sequence analysis software, Oligo primer design analysis software and other software to analyze and design GTF -PAc is fused with an anti-caries DNA vaccine and simulates the whole process of cloning. The primers in the GLU region were designed as follows: positive-strand primer: 5'TCACTCGAGGTACCGGAGAAATGGGCTATCAA3'; negative-strand primer: 5'CCCGGGTTAGTCGACAATCCGAACTCGTTC3', KpnI and SalI restriction sites were introduced at the 5' ends of the positive-strand and negative-strand primers, respectively. Using the polymerase chain reaction (PCR) method, the plasmid pYNB13 carrying the gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A DNA vaccine for fusional decayed tooth prevention is prepared from Esherichia coli JM109 / pGLUA-P CCTCC No.M201042 through PCR amplification of the plasmid pYNB13 carrying the gene gtfB of deformed streptococci GS-5 glucosyl transferase GTT-1 to obtain sequence GLU in glucosan binding region, cloning it to eukaryotic vector pCI to obtain eukaryotic expression plasmid pGLU, and linking it with the A-P fragment sequence in regions A and P of the surface protein PAc of deformed streptococci in pCIA-P plasmid. Its advantages are simple method, high safety, low cost, durable immune response and high effect.

Description

technical field [0001] The invention belongs to the technical field of oral preventive medicine, and in particular relates to a preparation method of PAc and GTFs fusion anti-caries DNA vaccine. Background technique [0002] Caries is a kind of bacterial infectious disease. Many scholars have proved that the genus Mutans Streptococci is highly related to caries, among which Streptococcus mutans and Streptococcus sobribus are the most important pathogenic bacteria that cause human caries. Glucosyltransferases (glucosyltransferaesGTFs) and surface protein (surface protein antigen PAc) (also known as antigen B, I / II, IF, P1) are important cariogenic virulence factors of Streptococcus mutans. GTF s Synthesize glucan and mediate the dextran-dependent adhesion of Streptococcus mutans on the tooth surface, and PAc is involved in mediating the non-glucan-dependent adhesion of bacteria to the acquired membrane on the tooth surface. The alanine-rich A region...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/108A61K48/00A61P1/02
CPCY02A50/30
Inventor 樊明文边专贾荣郭继华陈智彭彬范兵
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products