Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sclerotinite anti carbendazol detection gene and its detecting method

A technology of Sclerotinia sclerotiorum and carbendazim is applied in the field of Sclerotinia sclerotiorum anti-carbendazim detection gene and its detection field. Easy to learn, simple method, time-saving effect

Inactive Publication Date: 2005-07-13
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at the defects that the extraction of genomic DNA in the ASO-PCR detection technology of Sclerotinia sclerotiorum in the prior art is complicated, takes a long time, is not suitable for a large number of detections, and the detection accuracy is not too high, the improved method can be detected in time during the onset of rapeseed Antimicrobial resistance, a large number of simple detections can be carried out in a short period of time, and the detection accuracy rate can reach more than 95%. It is of practical value to take effective measures in time to control the epidemic of drug-resistant diseases in the season

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sclerotinite anti carbendazol detection gene and its detecting method
  • Sclerotinite anti carbendazol detection gene and its detecting method
  • Sclerotinite anti carbendazol detection gene and its detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 PCR amplification to obtain the β-tubulin gene associated with Sclerotinia sclerotiorum anti-multiple bacteria

[0029]According to the high homology of β-tubulin in other pathogenic fungi, 3 pairs of primers were designed.

[0030] BAF6 (5'ACCCACAACCGCCAACATGCGTGA3')

[0031] CP-1 (5'GGTGATCTGGAAACCCTGGAGGCA3')

[0032] B1(5'A(AG)AT(CT)ACCCA(CT)TC(CT)CT(CT)GGTGGTGG 3')

[0033] B3(5'CTCCAT(CT)TC(AG)TCCAT(ACT)CC(CT)TC(AG)CC 3')

[0034] BAF3 (5'GCTCGAGCGCATGAACGTCTACTT3')

[0035] END3(5'AT(TC)TA(CT)TCCTCGCCCTCAA3')

[0036] 50μL reaction system containing 100ng genomic DNA as template, 5μL 10×buffer (10mM Tris-HCl, 50mM KCl, 0.1% TritonX100), MgCl 2 2mM, TaqDNA polymerase 1U (Shanghai Promga), dNTP 0.2mM, primers 0.5μM each. Reaction conditions for primers B1 / B3: 94°C for 5 min, 1 cycle; 65°C for 2 min, 72°C for 2 min, 94°C for 1 min, 30 cycles; finally, 72°C for 5 min. BAF6 / CP-1 and BAF3 / END3 reaction conditions: 94°C for 5min; 60°C for 50s, 94°C for...

Embodiment 2

[0039] Example 2 Rapid detection of carbendazim resistance of Sclerotinia sclerotiorum on rape in Tongzhou City, Jiangsu Province in 2002

[0040] With the sclerotia collected back in 2002, 100 were randomly selected, and a small piece (30-50 mg) of the sclerotia was cut off respectively, and 3.5% (mg / L) NaClO 3 Disinfect for 5 minutes; add 1.5mL extraction buffer (100mmol / LLiCl; 10mmol / L EDTA; 10mmol / L Tris-HCl, pH8.0; 10g / L SDS) to the sterilized Sclerotinia sclerotiorum sclerotia block and add 0.2g of Quartz sand, fully ground; warm bath at 60°C for 10 minutes; centrifuge at 10,000 rpm for 4 minutes; suck out 700 μL of supernatant, and extract with 700 μL of extract (phenol, chloroform, isoamyl alcohol prepared in a volume ratio of 25:24:1) 2 times; suck out 600 μL of supernatant again, add 600 μL of isopropanol; place at -20°C for 1 hour; centrifuge at 10,000 rpm for 20 minutes; discard the supernatant, dry the precipitate, dissolve in 200 μL of TE buffer (10 mmol / L Tris-H...

Embodiment 3

[0046] Example 3 Rapid detection of carbendazim resistance of Sclerotinia sclerotiorum on rapeseed in Jurong City, Jiangsu Province in 2003

[0047] With the sclerotia collected back in 2003, 80 were randomly selected, and a small piece (30-50 mg) of the sclerotia was cut off respectively, and 3.5% (mg / L) NaClO 3 Disinfect for 5 minutes; add 1.5mL extraction buffer (100mmol / LLiCl; 10mmol / L EDTA; 10mmol / L Tris-HCl, pH8.0; 10g / L SDS, the rest is water, sterilized by autoclaving) and 0.2g of quartz sand that has been sterilized by autoclaving, fully ground; warm bath at 60°C for 10min; centrifuge at 10000rpm for 4min; suck out 700μL of supernatant, and use 700μL of extracting solution (phenol, chloroform, isoamyl alcohol according to The volume ratio was adjusted to 25:24:1) and extracted twice; 600 μL of supernatant was sucked out again, and 600 μL of isopropanol was added; placed at -20°C for 1 hour; centrifuged at 10,000 rpm for 20 minutes; TE buffer solution (10mmol / L Tris-H...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection gene of Sclerotinia sclerotiorum against carbendazim and a detection method thereof, and is specially used for the detection of Sclerotinia sclerotiorum against benzimidazole fungicides. The β-tubulin gene of Sclerotinia sclerotiorum related to anti-carbendazim was reported for the first time in the world. It only takes 6 hours to extract genomic DNA from the sclerotia collected from the field to the whole detection process of ASO-PCR, and the detection accuracy rate is over 96%, achieving a fast, simple, accurate and sensitive detection of Sclerotinia sclerotiorum against carbendazim. . Pictured: Genomic DNA extracted directly from sclerotia.

Description

1. Technical field [0001] The invention relates to a carbendazim-resistant detection gene of Sclerotinia sclerotiorum and a detection method thereof, which belong to the detection method of physiological races of plant pathogenic bacteria, and are specially used for detection of sclerotinia sclerotiorum resistant to benzimidazole fungicides such as carbendazim . 2. Technical background [0002] Sclerotinia sclerotiorum is a worldwide disease caused by Sclerotinia sclerotiorum (Lib.) de Bary, which seriously affects the yield and quality of rapeseed. For a long time, benzimidazole fungicides or compound agents based on such agents have been used for chemical control. Benzimidazole fungicides are used in production as a class of high-efficiency, broad-spectrum systemic fungicides, which solve the environmental toxicity problem of protective fungicides and improve the ability of humans to control the disease. Benzimidazole fungicides include carbendazim, benomyl, thiabendazol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 周明国李红霞陆悦健王建新
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com