Recombinant protein carrying target protein and autonomously entering eukaryotic cell, recombinant expression vector and recombinant bacterium and application

A recombinant protein and target protein technology, applied in the field of fusion proteins, can solve the problems of easy oxidation and discoloration of phospholipids, poor stability of liposomes, and easy precipitation, and achieve the effect of repairing CPD damage

Pending Publication Date: 2022-07-08
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although cosmetics based on liposome technology have been widely used, it has problems such as high preparation technology requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein carrying target protein and autonomously entering eukaryotic cell, recombinant expression vector and recombinant bacterium and application
  • Recombinant protein carrying target protein and autonomously entering eukaryotic cell, recombinant expression vector and recombinant bacterium and application
  • Recombinant protein carrying target protein and autonomously entering eukaryotic cell, recombinant expression vector and recombinant bacterium and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Analysis of the ability of SVNLS and AE1 to bring the exogenous protein GFP into the nucleus

[0059] 1) Construction and prokaryotic expression of SVNLS::GFP::AE1 protein expression vector.

[0060] When the green fluorescent protein GFP coding sequence was cloned by PCR, the coding sequences of SVNLS and AE1 were connected to the N-terminus and C-terminus of the GFP protein, respectively (where the stop codon in the GFP coding sequence was removed and added in front of SVNLS a translation initiation codon ATG).

[0061] Upstream primer SVNLS-GFP-5 (SEQ ID NO. 5) used for PCR amplification: CGGGATCCATGCCAAAAAAGAAGAGAAAGGTCGTGAGCAAGGGCGA GGA; downstream primer AE1-GFP-3 (SEQ ID NO. 6): CGGAATTCTTATCATTTTTTCCATTTCATGCGGCGGTTCTGAAACCAAATTTTAATCTGGCGGCCCTTGTACAGCTCGTCCA. Using the DNA fragment containing the GFP coding sequence as the template, the PCR amplification system (total volume 50 μL) is: ddH 2 O 15 μL, 2×Phanta Maxbuffer (Vazyme) 25 μL, dNTP Mix (10 μM each, Va...

Embodiment 2

[0074] Expression and preparation of recombinant protein SVNLS::MrPHR1::AE1

[0075] In order to use SVNLS and AE1 short peptide to bring the CPD photolyase (MAA_05216, named MrPHR1) of Metarhizium anisopliae into the nucleus of mammalian cells and repair the CPD damage on nuclear DNA, the present invention constructed a fusion protein SVNLS::MrPHR1:: AE1.

[0076] For this purpose, the coding sequences of SVNLS and AE1 were ligated to the N-terminus and C-terminus of the MrPHR1 protein, respectively, when the MrPHR1 coding sequence (Genbank accession number: XP_007821405) was cloned by PCR (where the stop codon in the MrPHR1 coding sequence was removed). , and add a translation initiation codon ATG in front of SVNLS). The primers used are SEQ ID NO.3 and SEQ ID NO.4, and the template is the cDNA of Metarhizium anisopliae mycelium. The amplification system and amplification procedure are the same as those in Example 1, wherein the upper and lower primers in the amplification...

Embodiment 3

[0084] Analysis of the ability of SVNLS::MrPHR1::AE1 to repair DNA CPD damage after entering the nucleus

[0085] 1) Photorepair of UV-treated HFF-1 cells

[0086] (1) Cell culture and processing setup

[0087] HFF-1 cells were passaged into Corning petri dishes with a diameter of 30 mm, cultured in a carbon dioxide incubator at 37°C for 3 days, and then treated as follows: a negative control without any treatment (untreated), cells were incubated with recombinant protein (Cell+ protein), UV irradiated cells (UV / cell), visible light irradiated UV-treated cells (Light+UV / cell), cells incubated with recombinant protein treated with UV radiation (UV+protein / cell), co-incubated with recombinant protein The incubated cells were UV-irradiated and then treated with visible light (Light+UV+protein / cell), each set in 3 replicates.

[0088] For cells co-incubated with recombinant proteins, UV irradiation followed by visible light treatment (Light+UV+protein / cell) In this setup, there ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a recombinant protein carrying a target protein and autonomously entering eukaryotic cells, a recombinant expression vector, a recombinant bacterium and application, and relates to the technical field of fusion proteins. The recombinant protein provided by the invention sequentially comprises a nuclear entry signal NLS, a target protein and a short peptide AE1 with cell membrane crossing capacity from an N end to a C end, and the nuclear entry signal NLS is used for bringing the recombinant protein into a cell nucleus. Wherein the AE1 is non-toxic and efficient to lead the recombinant protein to cross a cell membrane to enter a cell, and the target protein is brought into a cell nucleus by NLS so as to take effect. The invention also provides a recombinant photolytic enzyme capable of autonomously entering a human cell nucleus to repair DNA damage induced by UV radiation, a CPD photolytic enzyme is taken as a target protein, and the recombinant photolytic enzyme has the effects of repairing cyclobutane pyrimidine dimer (CPD) on cell nucleus DNA, improving the activity of intracellular superoxide dismutase (SOD) and reducing the level of intracellular oxygen free radicals (ROS) and highly toxic molecule malondialdehyde (MDA).

Description

technical field [0001] The invention belongs to the technical field of fusion proteins, and in particular relates to a recombinant protein, a recombinant expression vector and a recombinant bacteria that carry a target protein and enter eukaryotic cells autonomously, and applications thereof. Background technique [0002] Ultraviolet radiation can cause many hazards to humans. Ultraviolet rays in sunlight are divided into three categories according to wavelength. One is short-wave ultraviolet rays (UVC: 200-280nm), which are almost all absorbed by the atmospheric ozone layer. The second is medium-wave ultraviolet (UVB: 290-320nm), which accounts for only about 5% of ultraviolet rays in sunlight. Epidermal damage, including acute sunburn and hyperpigmentation, is mainly caused by UVB. The third is long-wave ultraviolet (UVA: 320-400nm), which accounts for up to 95% of ultraviolet rays in sunlight. Long-wave ultraviolet rays have strong penetrating ability and can reach the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N9/88C12N15/70C12N1/21A61K38/51A61P17/16A61P17/18C12R1/19
CPCC12N9/88C12Y401/99C12N15/70A61K38/51A61P17/16A61P17/18C07K2319/09C07K2319/03Y02A50/30
Inventor 方卫国包玉婷张明祥
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap