Method for fixed-point quantitative detection of cancer marker based on micro-fluidic chip
A cancer marker and microfluidic technology, applied in chemical instruments and methods, measuring devices, laboratory containers, etc., can solve the problems of low precision, time-consuming analysis, etc., to meet the detection accuracy and save the amount of solution , Reduce the effect of sample consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, but the present invention is not limited.
[0030] A microfluidic chip provided by the present invention is applied to the detection method of ovarian cancer marker CA125 in serum samples, which can realize preliminary screening of ovarian cancer according to the detection of CA125 content in serum, including the following steps:
[0031] The specific implementation process is as follows:
[0032] A method for detecting ovarian cancer markers in serum samples using a microfluidic chip, comprising the following steps:
[0033] 1. Design and detect the corresponding aptamer
[0034] (1) CA125 recognition strand: 5'-biotin-agttgccacc ttaagactca ctatagggag acaagaataaacgctcaagt cta-6-Carboxytetramethylrhodamine (TAMRA)-3' (SEQ ID No.1), which is a hairpin DNA with 54 deoxyribonucleotides in length, The CA125 recognition chain, the sequence that sp...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com