Fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for poria cocos and identification method

A detection kit and fluorescence quantitative technology, which are applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve threats to health, hinder the healthy development of Poria cocos industry, and affect the effectiveness of clinical medication, etc. question

Inactive Publication Date: 2022-03-15
BEIHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because of its unique pharmacological effects, Poria cocos has a high clinical compatibility rate and is highly sought after by people in the health care product market. Therefore, the Poria cocos market is full of chaos, and a large number of counterfeit products that are similar to its shape and easily confused are flooding the market. Currently, the most common counterfeit products on the market are There are polyporus, kudzu root, trichosanthemi and yam. Although these medicinal materials are similar in appearance, their efficacy is significantly different. The appearance of these counterfeit products will reduce the pharmacological effects of the medicinal materials and affect the effectiveness of clinical medication, which not only seriously damages and hinders the health of the poria cocos industry development, but also a serious threat to people's health, it is urgent to ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for poria cocos and identification method
  • Fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for poria cocos and identification method
  • Fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for poria cocos and identification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0045] Example two Poria cocos counterfeit medicinal materials are identified

[0046] 1. Materials

[0047] The standard and reference substances were purchased from the China National Institutes for Food and Drug Control and the National Standard Substance Resource Platform. 5 batches of standard Poria cocos, Polyporus, Pueraria lobata, Trichosanthes Fen, Chinese yam (batch numbers: 121117~201910, ycwkq20111201, 121551~201805, 121361~202004, 121137~201807)

[0048] 2. Method

[0049] 2.1 Genomic DNA extraction of test samples The modified CTAB method was used to extract the genomic DNA of the samples.

[0050] 2.2PCR primer design and synthesis

[0051] (1) Design a pair of Poria cocos-specific oligonucleotide primers, the following primers

[0052] Primer (Poria cocos, amplification length 101bp)

[0053] Forward primer: 5′GCACCGTCTACAAGCCATCTTCC3′

[0054] Reverse primer: 5′CCTCCCCCACGCCCCAATAAATG 3′

[0055] (2) Artificially synthesize ribosomal in vivo transcripti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of traditional Chinese medicine detection, in particular to a poria cocos fluorescent quantitative PCR (polymerase chain reaction) detection kit which is characterized by consisting of an identification reaction system, a positive control reaction system and a negative control reaction system. The method comprises the steps that a specific primer and an SYBR Green dye method are used for identifying the molecular characteristics of poria cocos, the sequence of an upstream primer used in the fluorescent quantitative PCR identification method is 5 '-GCACCGTACAGCCATCTTCC-3', the sequence of a downstream primer used in the fluorescent quantitative PCR identification method is 5 '-CCTCCCACCGCCCAATAAATG-3', and the method is characterized in that the total system is 20 [mu] L, 10 [mu] L of 2 * RealStar Green Power Mixture, 0.2 [mu] L of upstream and downstream primers, 0.2 [mu] L of DNA of a sample to be detected and the balance of double distilled water. A fluorescent quantitative PCR identification method for poria cocos comprises the steps of designing and synthesizing a pair of poria cocos specific oligonucleotide primers, determining a reaction procedure, judging a result and the like. The judgment standard is as follows: the certified tuckahoe product has a specific S-type amplification curve and the Ct value is less than 31. The tuckahoe fluorescent quantitative PCR detection kit and the identification method can accurately distinguish tuckahoe and counterfeit products thereof.

Description

technical field [0001] The invention relates to the technical field of detection of fungal traditional Chinese medicines, in particular to a poria cocos DNA fluorescent quantitative PCR detection kit and identification method. Background technique [0002] Poria cocos is the dried sclerotia of Poria cocos (Schw.) Wolf, a fungus of the Polyporaceae family. It is a traditional Chinese medicine that has been used for thousands of years in China. Diseases, can play its unique role, its chemical components are triterpenoids, polysaccharides, steroids, fatty acids, proteins, adenine, lecithin, amino acids and inorganic elements such as calcium, magnesium, iron, potassium, research shows that it has Regulating immune function, anti-tumor, anti-inflammatory and other pharmacological effects, as well as liver protection, anti-aging, hypoglycemic effects, etc., as a medicinal and edible fungus medicinal material, it is a good gift for relatives and friends. [0003] Poria cocos is a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11
CPCC12Q1/6895C12Q1/6851C12Q2531/113C12Q2563/107
Inventor 兰春阳李佩瑶李翔刘晓蓉李明成李丹
Owner BEIHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products