Construction method and application of iris plant eleutherine eleutherine VIGS silencing system
A construction method, the technology of shallots, applied in the field of plant genetic engineering, can solve the problems of lack of construction, lack of gene sequence information, self-genetic transformation system, functional research and synthesis mechanism of effective active ingredients, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030]Example 1: Establishment of shallot PDS gene VIGS system
[0031] 1. Method
[0032] (1) Strains
[0033] Escherichia coli DH5α competent cells (product specification CAT#: DL1001) and Agrobacterium GV3101 competent cells (product specification CAT#: AC1001) were purchased from Shanghai Weidi Biotechnology Co., Ltd.; pTRV1 vector (product number: BiovectorPTRV1), pTRV2 vector ( Item No.: BioVectorPTRV2) was purchased from Protin Biotechnology (Beijing) Co., Ltd.
[0034] (2) Reagents
[0035] RNA extraction kit: Beijing Huayueyang Ultrafast Plant RNA Extraction Kit; Reverse Transcription Kit: StarScript II cDNA First Strand Synthesis Premix Reagent (including degenome); DNA gel recovery kit: DiaSpin column DNA gel Recovery Kit; Plasmid Extraction Kit: SanPerp Column Plasmid DNA Small Extraction Reagent; Digestion and Ligation: ClonExpressII One Step Cloning Kit.
[0036] (3) Experimental process
[0037] ① In order to verify the feasibility of the VIGS system in stu...
Embodiment 2
[0068] Example 2: Using the VIGS system to carry out functional research on EbMYB5 and EbMYB52 genes in red onions
[0069] 1. Primer design and vector construction for EbMYB5 and EbMYB52
[0070] The vector construction method is the same as in Example 1. EbMYB5 (the gene nucleotide sequence is shown in SEQ ID NO.3) and EbMYB52 (the gene nucleotide sequence is shown in SEQ ID NO.4), in the VIGS experiment, the vector construction of pTRV2-EbMYB5 uses primers: Primer sequence 5'-3'F: TACCGAATTCTCTAGAGTGTGGCACACCCACTTAAAG; R: CTTCGGGACATGCCCGGGTCAGATATCAGGCAATTCCAGAG, the length of the target fragment is 300bp. The vector construction of pTRV2-EbMYB52 uses primers: primer sequence 5'-3'F: TACCGAATTCTCTAGACGACCCGTGTCCGTCGCCTCCCC; R: CTTCGGGACATGCCCGGGTCATGATCTATAGTATCTAATCAC, the target fragment length is 351bp. The enzyme cutting sites selected in the pTRV2 vector are Xba I: TCTAGA, upstream; Smal I: CCCGGG, downstream. After silencing by VIGS technology, TRV2-EbMYB5 or TRV2...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com