KASP-Flw-sau6198 molecular marker linked with wheat flag leaf width major QTL (quantitative trait locus) and application of KASP-Flw-sau6198 molecular marker
A kasp-flw-sau6198, molecular marker technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of not many molecular markers, achieve the effects of accurate and efficient detection, high accuracy, and improve the efficiency of selection and identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Obtainment of wheat flag leaf width QTL QFLW.sau-AM-4B.4 and its molecular marker KASP-Flw-sau6198
[0043] (1) Using the wheat line 'Ailanmai' as the female parent and the wheat variety 'LM001' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 121 lines were obtained to form a genetic mapping population.
[0044] (2) Identification of the flag leaf width phenotype of the recombinant inbred line population: analyze and identify the flag leaf width of the recombinant inbred line at the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate The width of the flag leaf is obtained, and the average value is obtained, which represents the width of the flag leaf of the strain.
[0045] (3) 55K SNP chip analysis
Embodiment 2
[0058] Example 2 Application of Molecular Marker KASP-Flw-sau6198 in Selection and Control of Flag Leaf Width QTL QFLW.sau-AM-4B.4
[0059] (1) Using the tetraploid wheat 'PI 503554' with narrower flag leaves as the male parent and the tetraploid local wheat 'Ailanmai' with wider flag leaves as the female parent to construct a recombinant inbred line, and randomly select the offspring lines 54 strains.
[0060] (2) Carry out KASP-Flw-sau6198 marker detection on the obtained 54 strains, the specific method is: extract the DNA of 54 strains; use it as a template, and use the specific primer pair of molecular marker KASP-Flw-sau6198 Perform PCR amplification and perform fluorescence readings for primers, which are:
[0061] Primers on the FAM tag: (the underlined part is the FAM tag sequence) 5'- GAAGGTGACCAAGTTCATGCT TCGACAGCCGGACTTCTCGA-3' (SEQ ID No. 1)
[0062] Primers on the HEX tag: (the wavy part is the HEX tag sequence) 5'-
[0063]
[0064] Universal downstream p...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com