Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Bicistronic DNA Vaccine for Grouper Viral Neuronecrosis

A DNA vaccine and bicistronic technology, applied in the field of fish immunology, can solve the problems of not very good immune protection effect, limited immune protection effect of fish body, not very good antigen immunogenicity, etc., and achieve good immune protection Effects, enhancement of humoral immunity, enhancement of the ability to resist nerve necrosis virus infection

Active Publication Date: 2022-05-10
OCEAN UNIV OF CHINA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the immune protection effect caused by the DNA vaccine against the current single antigen is not very good, and from the existing results, all the capsid proteins as antigens can only cause humoral immunity of fish in a small part, and the immunogenicity of the antigen is also low. Not very good, and the immune protection effect provided to fish is also limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Bicistronic DNA Vaccine for Grouper Viral Neuronecrosis
  • A Bicistronic DNA Vaccine for Grouper Viral Neuronecrosis
  • A Bicistronic DNA Vaccine for Grouper Viral Neuronecrosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The preparation method of anti-NNV bicistronic DNA vaccine comprises the steps:

[0028] 1. Construction of recombinant eukaryotic plasmids:

[0029]1. According to the multiple cloning site in the pBudCE4.1 plasmid and the sequence of the grouper interferon regulatory factor 3 and the NNV capsid protein (MT157514.1), use the primer design software Primer 5.0 to design the sequences with NotI, KpnI and Forward and reverse primers for Hindlll and EcoRI restriction sites,

[0030] IRF-3-F: ATTTGCGGCCGCATGTCTCATTCTAAACCACT;

[0031] IRF-3-R: CGGGGTACCGTACATCTCCCATCATCATCTCCTC;

[0032] CP-F: CGGAATTCATGGTACGCAAAGGTGAGAAG;

[0033] CP-R: GCGTCGACTTAGTTTTCCGAGTCAACCCT.

[0034] 2. Amplification and purification of the target gene: the IRF-3 gene was amplified by artificially synthesizing specific primers using the genomic DNA of the head and kidney of the pearl gentian grouper. The reaction conditions were: pre-denaturation at 95°C for 5 minutes; 35 cycles at 95°C for 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a bicistronic DNA vaccine for grouper viral neuronecrosis, which is a recombinant eukaryotic expression vector, and the recombinant eukaryotic expression vector can simultaneously express the P-domain of neuronecrosis virus capsid protein and the superfamily domain of the grouper interferon regulatory factor 3 protein. The anti-necrosis virus bicistronic DNA vaccine prepared by the invention can well express the neuronecrosis virus capsid protein P-domain and the superfamily domain of the host's interferon regulatory factor 3 protein when transfected into fish. The prepared anti-neuronecrosis virus bicistronic DNA vaccine enhances the ability of fish to resist nerve necrosis virus infection, reduces the mortality rate of fish infected with the virus, enhances the humoral immunity of fish caused by the vaccine, and causes fish body The comprehensive immune response provides a good immune protection effect for the fish body.

Description

technical field [0001] The invention belongs to the technical field of fish immunology, and in particular relates to a fish bicistronic DNA vaccine. Background technique [0002] Viral neuronecrosis (VNN), also known as retinopathy and viral encephalopathy (viral encephalopathy and retinopathy, VER), is listed as an important fish disease by the World Organization for Animal Health (OIE), and is a worldwide epidemic. The pathogen of the disease belongs to the Nodaviridae family (Nodaviridae), β-Nodavirus (Betanodavirus), the virus mainly infects the nervous system of aquatic animals, causing viral nerve necrosis, so the virus is also called nerve necrosis virus ( Nervous necrosis virus, NNV). The structure of NNV is an icosahedron without envelope, with a diameter of about 20-30nm, and the genome consists of two single-stranded positive-strand RNAs. Among them, RNA1 encodes the RNA polymerase required for virus replication; RNA2 encodes the viral capsid protein (CP), which...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/40C12N15/12A61K39/12A61P31/14A61P25/00
CPCC12N15/85C07K14/005C07K14/461A61K39/12A61P31/14A61P25/00C12N2800/107C12N2830/20C12N2770/30022C12N2770/30034A61K2039/53A61K2039/552
Inventor 邢婧林天雯战文斌唐小千绳秀珍迟恒
Owner OCEAN UNIV OF CHINA
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More