Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer composition for tumor methylation site detection and application thereof

A primer composition and methylation technology, which are applied in recombinant DNA technology, biochemical equipment and methods, and microbial determination/inspection, etc., can solve the problem of low mutation frequency of TERT promoter, and achieve the goal of not easy to degrade and easy to preserve. And the effect of transportation and easy operation

Active Publication Date: 2021-08-27
HUNAN LINGKANG MEDICAL TECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in many tumors, such as renal cancer, osteosarcoma, and cervical squamous cell carcinoma, mutations in the TERT promoter region are relatively rare, and the frequency of TERT promoter mutations is very low, so the detection method based on TERT promoter mutations has certain limitations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition for tumor methylation site detection and application thereof
  • Primer composition for tumor methylation site detection and application thereof
  • Primer composition for tumor methylation site detection and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 TERT Gene Methylation Site Screening

[0052] The present invention is based on the Illumina 450K chip of tumor patients in the TCGA database, and analyzes the difference in methylation degree according to the methylation sites on the TERT gene in tumor tissue and normal tissue, and identifies cg26006951, cg17166338 and cg07380026 as sites with significant methylation difference . in, figure 1 It is a comparison chart of the cg26006951 site in tumor tissue and normal tissue in the TCGA database, figure 2 It is a comparison chart of the cg07380026 locus of tumor tissue and normal tissue in the TCGA database, image 3 It is a comparison chart of cg17166338 loci in tumor tissue and normal tissue in the TCGA database, Figure 4 It is the relationship between the methylation level of cg26006951, cg07380026 and cg17166338 sites and the survival and prognosis of tumor patients, Figure 5 It is a graph showing the relationship between the methylation levels of c...

Embodiment 2

[0054] Example 2 Kit

[0055] 1. Primer composition

[0056] Primers were synthesized by SangonBiotech, and the specific primer sequences are as follows:

[0057] (1) Primers for detection of cg17166338:

[0058] F1: GATGTTGGTTTTATTTGTTAGATAGAGT SEQ ID NO: 1;

[0059] R1: ACAAACCACCCCAAATCTAT SEQ ID NO: 2;

[0060] S1: GGTTAAGGTAGTTGTGGTTG SEQ ID NO: 3;

[0061] (2) Primers for detection of cg26006951 and cg07380026:

[0062] F2: AGGTTGTTTTTTTATTTTGTG SEQ ID NO: 4;

[0063] R2: AATAAAAAATAAAACCAAAC SEQ ID NO: 5;

[0064] S2: GGTTTTATTTGTTAGATAGAGT SEQ ID NO:6.

[0065] Wherein, the above-mentioned F1 / R1 and F2 / R2 are amplification primers, S1 and S2 are sequencing primers, and the primers are methylation primers, that is, the primers are designed according to the sequence after methylation.

[0066] 2. The reaction system is shown in Table 2 below.

[0067] Table 2 reaction system

[0068]

[0069]

[0070] EpiTaqHS, MgCl 2 , 10×EpiTaqPCR Buffer, and dNTP Mixt...

Embodiment 3

[0077] Embodiment 3 TERT gene methylation detection

[0078] 1. Extract DNA samples from tumor tissues and normal tissues (or body fluids, such as blood, urine, etc.) according to the commercial genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP304).

[0079] 2. Take 0.5-1μg DNA sample, positive control sample or negative control sample, and use methylation conversion kit EZDNAMethylation-Gold TM Kit (manufacturer: ZYMO, product number: D5006) for transformation and purification.

[0080] 2.1 Sample homogenization: use a NanoDrop ND-2000 spectrophotometer to determine that the sample concentration is greater than 50ng / μL, and the total amount of the sample is greater than 500ng.

[0081] 2.2 Reagent preparation:

[0082] Reagent 1: add 900 μL H 2 O, put 300 μL M-Dilution Buffer and 50 μL M-Dissolving Buffer into CT Conversion Reagent tubes, and shake at room temperature for 10 minutes.

[0083] Reagent 2: Add 96mL of 100% ethanol to M-W...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer composition for detecting the methylation level of a TERT promoter and application thereof in tumor detection. With the application of the primer composition, the methylation levels of the cg26006951 site, the cg17166338 site and the cg07380026 site of the TERT promoter can be detected through the pyrosequencing technology so as to further perform pathological staging grading on the kidney cancer. The TERT promoter methylation level detection sensitivity and accuracy are high, which has important guiding significance for early detection, prognosis and risk assessment of kidney cancer.

Description

technical field [0001] The invention relates to the technical field of molecular biological detection, in particular to a primer composition and a kit for detecting tumor methylation sites and their application in the detection of tumor methylation sites. Background technique [0002] Tumor is formed by the mutation and proliferation of cells in a certain part of a living organism. Under the action of various carcinogenic factors, the growth of cells loses normal control and forms a tumor. Tumors can be divided into benign and malignant. Benign tumors are less harmful to the human body, while malignant tumors can cause serious harm and threaten human health and life. Malignant tumor, namely cancer, is a multiple lethal disease with complex process. [0003] With the continuous advancement of gene technology, molecular biology technology and cell biology technology, it is now clear that tumors are caused by the mutation of certain genes under the influence of various factors...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6869C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/154C12Q2600/112C12Q2600/118C12Q2531/113C12Q2535/122C12Q2565/301
Inventor 邓务国龙谦肖比苍
Owner HUNAN LINGKANG MEDICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com