Rapid detection method of food-borne burkholderia gladioli
A technology of Holderella and detection methods, which is applied in the directions of microorganism-based methods, microorganism determination/inspection, biochemical equipment and methods, etc., to achieve the effects of easy popularization, good application prospects, and rapid detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0034] A rapid detection method for food-borne Burkholderia gladiolus, characterized in that it comprises: performing a polymerase chain reaction in a polymerase reaction system, the reaction system containing amplified Gladiolus The specific primer pair of Kkholderia and Burkholderia gladiolus specific probe; The specific primer pair of described amplification Burkholderia gladiolus comprises: SEQ ID NO .1:16s-r:5'-GAATCCTACCGTGGTGACCGTCCTCCTTGCG-3'1460-1430;
[0035] SEQ ID NO.2:
[0036] 16S-F: 5'-AGCATGCCGCGGTGAATACGTTCCCGGGTCTT-3'1341-1372.
[0037] The Burkholderia gladiolus specific probe is a Taqman probe.
[0038] Further, the Burkholderia gladiolus specific probe has a nucleotide sequence selected from the following: SEQ ID NO.3:
[0039] 16S-P: ACACCGCCCGTCACACCATGGGAGTGGGTTTTTACCAC(FAMdT)(dSpa
[0040] cer)(BHQ1dT)GAAGTGGCTAGTC(phosphate) 1377-1425.
[0041] Further, a dSpacer is used at the position 37 bp away from the 5' end of the probe, and the two sides o...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com