Mutant of glutamate dehydrogenase gene promoter and application thereof
A glutamate dehydrogenase and promoter technology, applied in the direction of microorganism-based methods, enzymes, oxidoreductases, etc., can solve the problems of genome instability, increase strain burden, etc., achieve high application value, enhance expression intensity, Enhance the effect of expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1. Construction of Corynebacterium glutamicum gdh gene promoter strength characterization plasmid
[0060] In order to characterize the strength of the gdh gene promoter of Corynebacterium glutamicum, the present invention first constructs a characterization vector, on the basis of the pEC-XK99E plasmid backbone, expresses the N-terminal 60 amino acids of the gdh gene, a connecting peptide and red fluorescent protein gene. According to the published genome sequence and gdh gene annotation information of Corynebacterium glutamicum ATCC13032, the primer gdh-F / R was designed, and the gdh gene promoter and N-terminal 180bp DNA fragment were obtained by PCR amplification using the ATCC13032 genome as a template. pEC-XK99E-rfp reported in the literature (Wang Yingchun et al. Screening of endogenous high-efficiency constitutive promoters in Corynebacterium glutamicum based on time-series transcriptome[J]. Chinese Journal of Biotechnology, 2018,34(11):1760~1771) The...
Embodiment 2
[0063] Embodiment 2. Corynebacterium glutamicum gdh gene promoter mutant screening and intensity characterization
[0064] (1) Construction of Corynebacterium glutamicum gdh gene promoter mutant library
[0065] The core region " AATTCT of Corynebacterium glutamicum gdh gene promoter of the present invention TTGTGGTCA TATCTGTGCGACAC TGCCATAAT TGAACGTG" is mutated, and the underlined places are the main sequences of the -35 region and the -10 region of the promoter respectively. The present invention mutates "AATTCT at the corresponding position of the above core region TTGTNNNNA TATCTGTGCGACAC TNNNATAAT TGAACGTG", use gdh-M1 / M2 and gdh-M3 / M4 primers to amplify the two fragments of the plasmid respectively, and use Novizym's one-step recombination kit to clone and connect, collect all the cloned bacteria obtained and extract the plasmids to obtain The gdh gene promoter mutant library.The above library and the wild-type control pEC-XK99E-Pgdh-rfp obtained in Example 1 wer...
Embodiment 3
[0073] Embodiment 3. Corynebacterium glutamicum gdh gene promoter mutant is applied to proline production
[0074] (1) Evaluation of the construction of the basic strain SLCgP2 for proline production
[0075] According to literature reports, the introduction of the G149K mutation of glutamic acid kinase ProB can remove the feedback inhibition of proline, and the introduction of this mutation on the genome of the Corynebacterium glutamicum ATCC13032 strain can produce proline. The present invention introduces the Corynebacterium glutamicum ATCC13032 strain into G149K mutation, the codon was mutated from GGT to AAG, and the SLCgP1 strain was obtained.
[0076] The inventors further applied the P pyc -20 promoter (the nucleotide sequence of its core region is CGGGCCTTGATTGTAAGATAAGACATTTAGTATAATTAG, as shown in SEQ ID NO: 68, and the nucleotide sequence of the promoter is as shown in SEQ ID NO: 69) overexpressing glutamate that relieves feedback inhibition KinaseproB G149K The...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap