Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Method for rapidly detecting drug resistance of klebsiella pneumoniae to imipenem through real-time fluorescent PCR (polymerase chain reaction)

A Klebsiella imine and real-time fluorescence technology, which is applied in biochemical equipment and methods, and microbial measurement/inspection, can solve the problems of cumbersome methods, poor accuracy, and easy contamination, and achieve high throughput , fast speed, and the effect of shortening the detection time

Active Publication Date: 2021-06-25
杭州太斯特科技有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Among the bacterial drug susceptibility detection methods commonly used in clinical laboratories, the K-B method qualitatively judges the drug resistance of the bacteria to be tested by detecting the size of the bacterial inhibition zone, but cannot determine the MIC value; the E-test test strip detection method is simple to operate, The results are accurate, but the detection items are single and expensive; the automatic microbial identification system of the instrument only calculates the MIC value based on three drug concentration points, and the accuracy is not good; the broth dilution method is the gold standard for determining the MIC value, but this method is very cumbersome. Susceptible to contamination, poor repeatability
The above four methods all need to obtain pure bacteria and culture them for 16-24 hours to determine the drug resistance of the strains, which takes 2-3 days and seriously affects the clinical anti-infection treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly detecting drug resistance of klebsiella pneumoniae to imipenem through real-time fluorescent PCR (polymerase chain reaction)
  • Method for rapidly detecting drug resistance of klebsiella pneumoniae to imipenem through real-time fluorescent PCR (polymerase chain reaction)
  • Method for rapidly detecting drug resistance of klebsiella pneumoniae to imipenem through real-time fluorescent PCR (polymerase chain reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1: Design and screening of primers and probes

[0078] Search and download blaKPC, blaNDM, blaIMP, blaOXA-48 gene sequences and ompK36 mutant sequences through NCBI database, BLAST alignment, select specific conserved fragments, and use Primer Premier 5.0 to design primers and probes.

[0079] Primers and probes were synthesized and purified by Platinum Biotechnology (Shanghai) Co., Ltd. The probe is synthesized with fluorescent labeling at both ends. The fluorescent reporter group labeled at the 5' end of the probe is FAM, and the 3' end is labeled with a non-fluorescent quencher group TAMRA. After the synthesis of primers and probes, through a large number of test screening and combination testing, the detection primers and probes with sensitivity meeting the requirements are obtained.

[0080] The screened real-time fluorescent PCR primers and probes are:

[0081] blaKPC forward primer: CGATACCACGTTCCGTCTGG

[0082] blaKPC reverse primer: GCCATACACTCCGCAGG...

Embodiment 2

[0096] Example 2: Sensitivity and specificity detection of real-time fluorescent PCR

[0097] In this embodiment, 259 strains of Klebsiella pneumoniae isolated from clinics in Lishui Central Hospital were used as test samples. Specific steps are as follows:

[0098] 1. Template preparation: Scrape an appropriate amount of sample colonies from the Columbia blood agar plate and dissolve in ultra-clean water; heat at 100°C for 10 minutes, centrifuge at 12000r for 5 minutes, and take the supernatant as a template.

[0099] 2. PCR amplification of bla KPC 、bla NDM 、bla IMP 、bla OXA-48 and omp K36 The full-length sequence of the mutation is sequenced using first-generation sequencing technology to confirm whether each sample carries the above DNA sequence.

[0100] Of the 259 strains, 42.1% did not carry bla KPC 、bla NDM 、bla IMP 、bla OXA-48 , 24.3% carry bla KPC without omp K36 Mutated sequence, 24.7% carry bla at the same time KPC with omp K36 mutant sequence.

[01...

Embodiment 3

[0103] Embodiment 3: Confirmation of result judgment criteria

[0104] The test samples used in this example are the same as in Example 2, and the result interpretation standard is determined by comparing the real-time fluorescent quantitative PCR results with the drug sensitivity results. Specific steps are as follows:

[0105] The MIC values ​​of imipenem in all 259 samples were tested using the Wenzhou Kangtai Drug Sensitivity Panel. Comparing the imipenem susceptibility results of each sample with the gene carrying situation determined in Example 2, it was found that: bla KPC 、bla NDM 、bla IMP 、blaOXA-48 98.2% of all negative bacterial strains were sensitive; bla KPC positive while omp K36 Mutation-negative strains were all drug-resistant, of which 4μg / mL≤MIC≤16μg / mL accounted for 96.8%, and MIC≥32μg / mL accounted for 3.2%; bla KPC The MIC values ​​of the double-positive strains with porin ompK gene mutation were all greater than 16 μg / mL, and 89.1% of the strains had...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for rapidly detecting the drug resistance of klebsiella pneumoniaeto imipenem through real-time fluorescent PCR, which comprises the following steps: scraping a klebsiella pneumoniae strain to be detected, dissolving the klebsiella pneumoniae strain in water, carrying out thermal cracking, centrifuging, and taking supernatant as a PCR detection sample; respectively using five groups of specific primers and probes to detect whether a sample contains carbapenemase gene blaKPC, blaNDM, blaIMP, blaOXA-48 and ompK36 mutation sequences or not through real-time fluorescent PCR, and judging the drug resistance of a sample strain to imipenem; The method has the beneficial effects that the target spot is new, and the drug resistance of the klebsiella pneumoniae carrying blaKPC to imipenem is detected and judged by virtue of the ompK36 mutation sequence; the speed is high, the drug resistance of the strain can be determined only by culturing for 1 day after pure bacteria are obtained by an existing clinical common method, however, the method only needs 2 hours, and the detection time is greatly shortened; and the result is precise and the flux is high.

Description

technical field [0001] The invention belongs to the technical field of drug sensitivity detection methods, and in particular relates to a method for rapidly detecting imipenem drug resistance of Klebsiella pneumoniae based on real-time fluorescent PCR. Background technique [0002] Carbapenem-Resistant Enterobacteriaceae (CRE) infection has a high mortality rate and is easy to spread. Moreover, the detection rate and infection rate of CRE are increasing year by year, and the resistance rate of Klebsiella to imipenem has increased rapidly from 0.4% in 2005 to 20% in 2017, seriously threatening national health. [0003] The mechanism of carbapenem resistance in CRE mainly includes the production of carbapenemase and the combination of porin mutation and high expression of β-lactamase, among which the former is the main reason, and the porin ompK36 mutation only plays a synergistic effect , can increase CRE drug resistance to a certain extent. At present, about 90% of all CRE...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12Q1/04
CPCC12Q1/689C12Q1/686C12Q2563/107C12Q2561/113Y02A50/30
Inventor 黄建胜
Owner 杭州太斯特科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com