Construction method of immortalized forest musk gland epithelial cells
A technology of epithelial cells and construction methods, applied in the field of construction of immortalized forest musk gland epithelial cells, can solve problems such as apoptosis, achieve the effect of overcoming apoptosis and ensuring growth speed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1-3
[0058] In following embodiment 1-3:
[0059] The complete epithelial cell culture medium used is PriMed-iCell-001 Saibikang (Shanghai) Biotechnology Co., Ltd.;
[0060] The SV40 overexpression lentivirus used (such as Figure 9 Shown) purchased from Hanyin Biology;
[0061] The target sequence information of the vector is as follows:
[0062] gtggttcaaagtttttttcttccatttcaggtgtcgtgaggatctatttccggtgaattc(atggataaagttttaaacagagaggaatctttgcagctaatggaccttctaggtcttgaaaggagtgcctgggggaatattcctctgatgagaaaggcatatttaaaaaaatgcaaggagtttcatcctgataaaggaggagatgaagaaaaaatgaagaaaatgaatactctgtacaagaaaatggaagatggagtaaaatatgctcatcaacctgactttggaggcttctgggatgcaactgagattccaacctatggaactgatgaatgggagcagtggtggaatgcctttaatgaggaaaacctgttttgctcagaagaaatgccatctagtgatgatgaggctactgctgactctcaacattctactcctccaaaaaagaagagaaaggtagaagaccccaaggactttccttcagaattgctaagttttttgagtcatgctgtgtttagtaatagaactcttgcttgctttgctatttacaccacaaaggaaaaagctgcactgctatacaagaaaattatggaaaaatattctgtaacctttataagtaggcataacagttataatcataacatact...
Embodiment 1
[0065] A method for constructing immortalized forest musk gland epithelial cells, comprising the steps of:
[0066] (1) Gather the glandular tissue of male adult muscaria sinensis that fell ill and died during the fragrance secretion stage; transfer it to PBS containing penicillin and streptomycin immediately after gathering, and the penicillin streptomycin is 100U / ml;
[0067] (2) the musk deer gland tissue collected in step (1) (such as figure 1 and figure 2 Shown) the musk deer glandular epithelial cells and fibroblasts are separated and purified to obtain the musk deer musk glandular epithelial cells after purification; specifically include the following steps:
[0068] ①Chop the musk deer gland tissue collected in step (1) to 1-2mm 3 ; Then digested with 0.2% type IV collagenase at 37°C for 4 hours; then resuspended and washed 3 times with complete medium; centrifuged at 1600r / m for 2.5min, and collected the supernatant;
[0069] ② Inoculate the supernatant collected ...
Embodiment 2
[0088] A method for constructing immortalized forest musk gland epithelial cells, comprising the steps of:
[0089] (1) Gather the glandular tissue of male adult muscaria sinensis that fell ill and died during the fragrance secretion stage; transfer it to PBS containing penicillin and streptomycin immediately after gathering, and the penicillin streptomycin is 100U / ml;
[0090] (2) Separating and purifying the musk deer glandular epithelial cells and fibroblasts of the musk deer musk glandular tissue collected in step (1) to obtain the musk deer musk glandular epithelial cells after purification; specifically comprising the following steps:
[0091] ①Chop the musk deer gland tissue collected in step (1) to 1-2mm 3 ; Then digested with 0.3% type IV collagenase at 37°C for 5 hours; then resuspended and washed twice with complete medium; centrifuged at 1300r / m for 3min, and collected the supernatant;
[0092] ② Inoculate the supernatant collected in step ① into a complete medium...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com