Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for improving natural immunity of piglets by utilizing ERV insertion polymorphism of pig TLR6 gene and breeding method of molecular marker

A technology of molecular markers and immunity, applied in the field of molecular marker-assisted selection of pigs, can solve problems affecting plant disease resistance and adaptability

Pending Publication Date: 2021-03-19
YANGZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is believed that the insertion of activated transposons into the genome may induce cell reprogramming to regulate gene expression to resist and adapt to adverse conditions, thereby affecting plant disease resistance and adaptability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for improving natural immunity of piglets by utilizing ERV insertion polymorphism of pig TLR6 gene and breeding method of molecular marker
  • Molecular marker for improving natural immunity of piglets by utilizing ERV insertion polymorphism of pig TLR6 gene and breeding method of molecular marker
  • Molecular marker for improving natural immunity of piglets by utilizing ERV insertion polymorphism of pig TLR6 gene and breeding method of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0045] Specific embodiment one: a kind of molecular marker breeding method of improving the natural immunity of piglets by using the ERV insertion polymorphism of the pig TLR6 gene in this embodiment, the method is realized by detecting the 192bp ERV insertion polymorphism in the 5' regulatory region of the TLR6 gene in the pig genome of. The genotype of this locus is selected as ERV + / + The selected pigs are the selected targets, and the target pigs are selected and retained, that is, the molecular marker breeding for improving the natural immunity of pigs is completed.

specific Embodiment approach 2

[0046] Embodiment 2: The difference between this embodiment and Embodiment 1 is that the direct electrophoresis method of PCR products can be used, which is simple and efficient.

specific Embodiment approach 3

[0047] Specific embodiment three: the difference between this embodiment and specific embodiment one is: the sequence of the primer pair used for genotyping at the ERV insertion polymorphic site is as follows:

[0048] Forward primer: CCAGCTACCAGCTATGTGACTTT;

[0049] Reverse primer: GGTGATATCTCGCTATGACTTTGA.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker for improving natural immunity of piglets by utilizing ERV insertion polymorphism of a pig TLR6 gene and a breeding method of the molecular marker, and relates to the field of molecular genetics. After 192 bp ERV is inserted, the promoter activity of the TLR6 gene is remarkably improved, and the expression of TLR6 and TLR1 in a TLR signal path related to natural immunity, downstream MyD88, Rac1, TOLLip, TIRAP and cytokine IL-6, IL-8 and TNF alpha genes in important immune organs of 30-day-old piglets and the levels of IL-6 and TNF alpha factor in bloodare increased. Therefore, the 192bpERV insertion polymorphism of the pig TLR6 gene can be detected to serve as the molecular marker for improving the natural immunity of piglets, the method is simple, convenient and rapid, moreover, the method is not affected by the environment, and early-stage selection and assortative mating can be achieved.

Description

technical field [0001] The invention relates to the field of molecular marker-assisted selection of pigs, in particular to a breeding method for improving the natural immunity of pigs, and selection is carried out by judging the ERV insertion polymorphism at the 5' end of pig TLR6 gene, so as to realize the selection of pigs with high resistance education. Background technique [0002] As a big pig breeding and consumption country, my country's consumption accounts for about 50% of the world's total. However, with the continuous expansion of the scale of intensive pig farming, the frequent occurrence of pig diseases has caused the performance of pigs to decline, and the death of pigs, especially early pigs, has become an important bottleneck restricting the development of China's pig industry. Vaccination and the use of antibiotics can reduce the incidence of pigs, control the spread of diseases, and maintain the health of pigs to a certain extent, but the extensive use of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q2600/124Y02P60/87
Inventor 王宵燕陈子璇安亚龙陈才宋成义高波
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com