Application of LINC024724 as colorectal cancer diagnosis marker and treatment target
A colorectal cancer, long-chain non-coding technology, applied in the field of colorectal cancer diagnostic markers and therapeutic targets, can solve problems such as bleeding and infection, high cost, and radiation dose accumulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] This example provides the application of LINC02474 in the diagnosis of colorectal cancer based on the study of the expression of LINC02474 in colorectal cancer and its regulatory effect on the biological function of colorectal cancer.
[0041] The corresponding deoxyribonucleotide sequence of LINC02474 is shown below, which is derived from human chromosome 1, and its position is as follows: figure 1 shown.
[0042] >NR_149071.1 Homo sapiens long intergenic non-protein coding RNA 2474(LINC02474), long non-coding RNA
[0043] CCTCCTGCTCTTTGCTCCGTGAGAAAGATCCACCTACGACCTCAGGTCCTCAGACCGACTAGCCCAAGAAACATCTCACCAATTTCAAATCTGACCTTTGCAAGAGGGTCCGAGACATTTGCATCATCATTCAGTGAGACCTGTAAACACAGCATCTGCCTTTGACCACATCCATCTGGAAGAACCTGAGAGATAATCCATTTTATGAAATTTTCCCTACCCTGAAATGGGAGAATGAATCTAATTTGAAGCACTGAGAAGGATAAGGCATCCATTTGAAAAGGACTCCTATATTGCAACATGAATTCTGCTAAAATTGAAGCAAGAACAAACATCAAATTTATGATGAAGTTTGGGTAGAAGAACGATGAAATTAGTGACGCTTTATAAAAAGTTTATTGGGACAATACCCCAAATGAATCAGCAGTTTAAAAATGGATA。
[0044] I...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com