Recombinant microorganism for producing sialic acid and application of recombinant microorganism
A technology for recombining microorganisms and sialic acid, applied in the direction of microorganisms, microorganism-based methods, recombinant DNA technology, etc., can solve problems such as difficult to meet industrial production and low yield of sialic acid
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0075]Example 1 Construction of starting strain
[0076]In this example, E. coli BL21 was used as an example to construct a starting strain capable of synthesizing sialic acid, specifically: knocking out the nanATEK gene cluster in E. coli BL21 (purchased from the China Industrial Microbial Culture Collection) and introducing the overexpression plasmid pXMJ at the same time -neuBC, to obtain the starting strain BL21△nanATEK / pXMJ-neuBC capable of producing sialic acid.
[0077]1. Knockout of nanATEK
[0078]Use Red recombination method to knock out nanATEK (gene cluster sequence is shown in SEQ ID NO.16), the specific method is as follows: use nan-F (ggtataacaggtataaaggtatatcgtttatcagacaagcatcacttcagaggtatttgtgtaggctggagctgcttc) and nan-R (tcataatttccgcgcgccAddcatcagtcagtcagtcagcat from Daccaccaccgcagcgcgcgcgcgcc) and nan-R (tcataatttccgcgcgcgcgcc) as the plasmid gaccatcagcc A PCR fragment of 1.3Kb was obtained for template amplification, and the fragment was transferred into E. coli BL21 con...
Embodiment 2
[0083]Example 2 Construction of recombinant bacteria overexpressing glucosamine 6-phosphate synthase or its mutants
[0084]On the basis of the starting strain constructed in Example 1, the glucosamine 6-phosphate synthase (amino acid sequence is shown in SEQ ID NO. 1 and the coding gene sequence is shown in SEQ ID NO. 2) or its mutants were further overexpressed E15K+D387V+S450P+E525G (amino acid sequence is shown in SEQ ID NO.11, coding gene sequence is shown in SEQ ID NO.12), the specific method is as follows:
[0085]1. Construction of a plasmid that overexpresses glucosamine 6-phosphate synthase glmS or its mutant glmS*
[0086]The artificially synthesized glmS* mutant gene, whose sequence is shown in SEQ ID NO.12, contains the following mutation E15K compared with glmS derived from E. coli W3110 (wild-type glmS, the sequence is shown in SEQ ID NO.2), D387V, S450P, E525G, compared with wild-type glmS, the enzyme activity is higher and is not inhibited by acetylglucosamine. Insert neuBC ...
Embodiment 3
[0089]Example 3 Construction of recombinant bacteria that simultaneously overexpress glucosamine 6-phosphate synthase and fructose-1,6-bisphosphate
[0090]Fructose-1,6-bisphosphate can catalyze the dephosphorylation of fructose-1,6-bisphosphate to produce fructose 6-phosphate. The present invention finds that it is further based on overexpression of 6-phosphate glucosamine synthase or its mutants. Overexpression of fructose-1,6-bisphosphatase glpX can further increase the production of sialic acid.
[0091]At the same time overexpression of E. coli 6-phosphate glucosamine synthetase (amino acid sequence is shown in SEQ ID NO. 1, coding gene sequence is shown in SEQ ID NO. 2) or its mutant (amino acid sequence is shown in SEQ ID NO. As shown, the coding gene sequence is shown in SEQ ID NO. 12) and fructose-1,6-bisphosphate (amino acid sequence is shown in SEQ ID NO. 3, and the coding gene sequence is shown in SEQ ID NO. 4) The construction method of recombinant bacteria is as follows:
[009...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com