KASP primers for detecting tomato yellow leaf curl virus disease-resistant gene Ty-1 and application of KASP primers
A technology of tomato yellowing and curved leaves and disease-resistant genes, applied in the fields of molecular biology and crop breeding, can solve the problems of undiscovered KASP markers, etc., and achieve the effects of improving breeding efficiency, saving breeding costs, and reducing workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Development of KASP markers
[0068] By comparing and analyzing the sequences of the two alleles of Ty-1 disease resistance and disease susceptibility, the alleles of Ty-1 disease resistance were named Ty-1 / Ty-1, and the alleles of Ty-1 disease resistance were named ty-1 / ty-1; and both of them have a SNP site at the 3461bp position. This SNP site meets the requirements for KASP marker development: the genotypes are different at 3461 bp; there are no other SNP sites nearby, and it is located in a non-SNP-intensive area; and complex sequences with high content of continuous AT and GC are avoided.
[0069] Therefore, the 3461st T / C site is used as the only selection target; the genotype of Ty-1+ is T at this site, and the genotype of Ty-1 is C.
[0070] KASP primers were designed according to the above SNP sites, and the primer sequences were:
[0071] No. 3461 T / C:
[0072] Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT TCAATGAACCTTCATCTCCATGT-3';
[0073] Forward prim...
Embodiment 2
[0078] Amplification of molecular markers
[0079] The materials used in this example are the high-generation homozygous disease-resistant material P808-1 (Ty-1 / Ty-1) and the susceptible material P802-1 (ty-1 / ty-1) selected by the applicant. Field identification shows resistance and susceptibility (the same below), and P808-1-P802-1-F1 hybrid disease-resistant material (Ty-1 / ty-1) prepared by crossing the two as parents. Leaf tissues of plants were collected for genomic DNA extraction.
[0080] According to the instructions of the Plant DNA Isolation Kit (Chengdu Fuji Biotechnology Co., Ltd.), the genomic DNA in the leaves of the above materials was extracted, and the concentration of the extracted DNA solution was diluted to 50-100ng / μl, and stored at -20°C.
[0081] Configure the PCR reaction system according to the requirements of the KASP-PARMS kit (Wuhan Jingpeptide Biotechnology Co., Ltd.), with a total reaction volume of 10 μl, including: 2X PARMS PCR Mix: 5 μl; DNA ex...
Embodiment 3
[0084] Detection and Analysis of Amplified Products
[0085] Use the software that comes with Applied Biosystems 7500Real-Time PCR System to perform genotyping and data analysis on PCR products, where the value on the ordinate is set to represent the FAM fluorescence signal value, and the value on the abscissa to represent the HEX fluorescence signal value.
[0086] Genotyping results see figure 1 . Among them, the dot I is the amplification signal of the disease-resistant material P808-1, and only the FAM fluorescence signal is detected; the dot II is the amplification signal of the heterozygous disease-resistant material P808-1-P802-1-F1, which was detected simultaneously FAM fluorescence and HEX fluorescence; the dot at III is the amplification signal of the susceptible material P802-1, and only the HEX fluorescence signal is detected; the black dot at IV near the origin represents the amplification signal of the negative control (without adding DNA sample). increase sign...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com