A KASP molecular marker linked to wheat flag leaf long qtl QFll-2B and its application
A molecular marker, kasp-fll-sau1 technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of insufficient molecular markers, achieve accurate and efficient detection, improve selection and identification efficiency, and high success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Obtainment of Wheat Flag Leaf Length QTLQFLL-2B and Its Molecular Marker KASP-Fll-sau1
[0044] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.
[0045] (2) Identification of the flag leaf length phenotype of the recombinant inbred line population: analyze and identify the flag leaf length of the recombinant inbred line at the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate The flag leaf length was obtained, and the average value was obtained, representing the flag leaf length of the strain.
[0046] (3) 55K SNP chip analysis
[0047] a) DNA extraction: The DNA of the parent '20828', 'SY95-71...
Embodiment 2
[0064] Example 2 Application of Molecular Marker KASP-Fll-sau1 in Selection and Control of Flag Leaf Length QTLQFLL-2B
[0065] (1) The common wheat line 'S849-8' with shorter flag leaves was used as the female parent, and the common wheat line 'SY95-71' with longer flag leaves was used as the male parent to construct a recombinant inbred line, and the offspring lines were randomly selected 70 strains.
[0066] (2) Carry out KASP-Fll-sau1 marker detection on the obtained 70 strains, the specific method is: extract the DNA of 70 strains; use it as a template, and use the specific primer pair of molecular marker KASP-Fll-sau1 Perform PCR amplification and perform fluorescence readings for primers, which are:
[0067] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0068] 5'- GAAGGTGACCAAGTTCATGCT TATCCTATGGAGTTGGAAAG-3' (SEQ ID No. 1)
[0069] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0070]
[0071] Universal downstream p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap